LCP2 (Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa), LCP2)

Short Description: SLP-76 was originally identified as a substrate of the ZAP-70 protein tyrosine kinase following T cell receptor (TCR) ligation in the leukemic T cell line Jurkat. The SLP-76 locus has been localized to human chromosome 5q33 and the gene structure has been partially characterized in mice. The human and murine cDNAs both encode 533 amino acid proteins that are 72% identical and comprised of three modular domains. The NH2-terminus contains an acidic region that includes a PEST domain and several tyrosine residues which are phosphorylated following TCR ligation. SLP-76 also contains a central proline-rich domain and a COOH-terminal SH2 domain. A number of additional proteins have been identified that associate with SLP-76 both constitutively and inducibly following receptor ligation, supporting the notion that SLP-76 functions as an adaptor or scaffold protein. Studies using SLP-76 deficient T cell lines or mice have provided strong evidence that SLP-76 plays a positive role in promoting T cell development and activation as well as mast cell and platelet function. [provided by RefSeq, Jul 2008].
More information related to gene LCP2.
Products related to LCP2 Gene:
135 Products
Type
  • 129
  • 6
Species
  • 56
  • 43
  • 28
  • 2
  • 2
Application
  • 87
  • 32
  • 25
  • 16
  • 1
Fusion tag
  • 49
  • 15
  • 13
  • 10
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 63
  • 36
  • 12
  • 9
  • 4
Insert
  • 50
  • 43
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 58
  • 48
  • 18
  • 5
  • 2
Expression Type
  • 97
  • 50
  • 26
  • 2
Selectable Marker
  • 26
  • 26
  • 24
  • 1
Promoter
  • 44
  • 30
  • 30
  • 13
  • 8
Format
  • 64
  • 27
  • 22
  • 22

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
3937 (Human, LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804440
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
513244 (Cow (Bovine), LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858277
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
16822 (Mouse (Murine), LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809411
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
444194 (Xenopus laevis, LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850003
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
155918 (Rat (Rattus), LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048183
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
NCBI Accession:
NM_005565
Species:
Human
Synonyms:
Lcp2, LCP2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103898
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
NCBI Accession:
NM_010696
Species:
Mouse (Murine)
Synonyms:
Lcp2, LCP2
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103714
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa)
Species:
Human
Synonyms:
AI323664, BB161688, SLP-76, SLP76, twm, Slp76
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189516
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Species:
Human
Synonyms:
Lcp2, LCP2
Insert length:
1602 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5746527
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
16822 (Mouse (Murine), LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809409
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
3937 (Human, LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804438
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
513244 (Cow (Bovine), LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858278
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
444194 (Xenopus laevis, LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850004
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
155918 (Rat (Rattus), LCP2)
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048184
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Gene ID:
3937 (Human, LCP2)
Synonyms:
Lcp2, LCP2
Insert length:
1602 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5322675
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
NCBI Accession:
NM_005565,NP_005556
Species:
Human
Synonyms:
Lcp2, LCP2
Insert length:
2390 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3384836
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
NCBI Accession:
NM_005565,NP_005556
Species:
Human
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3319035
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Species:
Human
Synonyms:
Lcp2, LCP2
Insert length:
1602 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4477472
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Species:
Human
Synonyms:
Lcp2, LCP2
Insert length:
1602 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4620943
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa) (LCP2)
Species:
Human
Synonyms:
Lcp2, LCP2
Insert length:
1602 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4705313
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to LCP2

  • lymphocyte cytosolic protein 2 (Lcp2)
  • lymphocyte cytosolic protein 2 (LCP2)
  • AI323664
  • BB161688
  • SLP-76
  • SLP76
  • Slp76
  • twm

Gene-IDs for different species

GENE IDSPECIES
16822 Mus musculus
155918 Rattus norvegicus
3937 Homo sapiens
100511843 Sus scrofa
489126 Canis lupus familiaris
513244 Bos taurus

Protein level used designations for LCP2

  • SH2 domain-containing leukocyte protein of 76 kDa
  • SLP-76 tyrosine phosphoprotein
  • lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)
  • 76 kDa tyrosine phosphoprotein
  • SH2 domain-containing leukocyte protein of 76kD
  • lymphocyte cytosolic protein 2
  • tyrosine phosphoprotein slp-76
Other products related to LCP2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com