Mesothelin (Mesothelin, MSLN)

Short Description: This gene encodes a precursor protein that is cleaved into two products, megakaryocyte potentiating factor and mesothelin. Megakaryocyte potentiation factor functions as a cytokine that can stimulate colony formation in bone marrow megakaryocytes. Mesothelian is a glycosylphosphatidylinositol-anchored cell-surface protein that may function as a cell adhesion protein. This protein is overexpressed in epithelial mesotheliomas, ovarian cancers and in specific squamous cell carcinomas. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010].
More information related to gene Mesothelin.
Products related to Mesothelin Gene:
140 Products
Data Quality
  • 1
Type
  • 132
  • 8
Species
  • 76
  • 31
  • 31
  • 2
Application
  • 81
  • 31
  • 27
  • 18
  • 1
Fusion tag
  • 45
  • 27
  • 20
  • 11
  • 8
Vector Backbone
  • 12
  • 12
  • 6
  • 6
  • 6
Vector
  • 53
  • 47
  • 12
  • 9
  • 7
Insert
  • 51
  • 39
  • 24
  • 10
  • 6
Oligo-Type
  • 7
  • 1
Resistance Gene
  • 50
  • 44
  • 34
  • 4
  • 2
Expression Type
  • 113
  • 56
  • 11
Selectable Marker
  • 31
  • 26
  • 11
Promoter
  • 52
  • 36
  • 25
  • 15
  • 8
Format
  • 67
  • 30
  • 27
  • 16

Type:
ORF
Application:
Cloning
Gene:
Mesothelin (MSLN)
Species:
Human
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Insert length:
1869 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5726690
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mesothelin (MSLN)
NCBI Accession:
NM_013404,NP_037536
Species:
Human
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Insert length:
1893 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5356479
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
516237 (Cow (Bovine), MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063124
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
60333 (Rat (Rattus), MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046750
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
10232 (Human, MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088750
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
10232 (Human, MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088751
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
56047 (Mouse (Murine), MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3816761
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mesothelin (MSLN)
Species:
Human
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562551
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Mesothelin
Species:
Human
Synonyms:
MPF, SMRP, MSLN
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190083
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
516237 (Cow (Bovine), MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063123
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
60333 (Rat (Rattus), MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046749
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
10232 (Human, MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088753
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
10232 (Human, MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088752
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
56047 (Mouse (Murine), MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3816762
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Mesothelin (MSLN)
Gene ID:
10232 (Human, MSLN)
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Insert length:
1869 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5317904
$199.17
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mesothelin (MSLN)
Species:
Human
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Insert length:
1869 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4439410
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mesothelin (MSLN)
Species:
Human
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Insert length:
1869 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478315
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mesothelin (MSLN)
Species:
Human
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Insert length:
1869 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4706481
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mesothelin (MSLN)
Species:
Human
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Insert length:
1869 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4621786
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mesothelin (MSLN)
Species:
Human
Synonyms:
MSLN, Msln, LOC611363, LOC100524016
Insert length:
1869 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4835611
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to Mesothelin

  • mesothelin (MSLN)
  • mesothelin (Msln)
  • mesothelin (LOC611363)
  • mesothelin (LOC100524016)
  • MPF
  • MSLN
  • SMRP

Gene-IDs for different species

GENE IDSPECIES
10232 Homo sapiens
56047 Mus musculus
60333 Rattus norvegicus
416534 Gallus gallus
516237 Bos taurus
611363 Canis lupus familiaris
698095 Macaca mulatta
100722390 Cavia porcellus
100524016 Sus scrofa
453806 Pan troglodytes

Protein level used designations for Mesothelin

  • CAK1 antigen
  • megakaryocyte potentiating factor
  • pre-pro-megakaryocyte-potentiating factor
  • soluble MPF mesothelin related protein
  • ERC/mesothelin
  • protein expressed in renal carcinoma
  • mesothelin
Other products related to Mesothelin such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com