MMP2 (Matrix Metalloproteinase 2, MMP2)

Short Description: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. This gene encodes an enzyme which degrades type IV collagen, the major structural component of basement membranes. The enzyme plays a role in endometrial menstrual breakdown, regulation of vascularization and the inflammatory response. Mutations in this gene have been associated with Winchester syndrome and Nodulosis-Arthropathy-Osteolysis (NAO) syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene MMP2.
Products related to MMP2 Gene:
Data Quality
  • 2
  • 123
  • 4
  • 64
  • 28
  • 27
  • 2
  • 2
  • 78
  • 31
  • 21
  • 16
  • 1
Fusion tag
  • 48
  • 15
  • 15
  • 11
  • 8
  • 5
Vector Backbone
  • 11
  • 7
  • 7
  • 6
  • 6
  • 50
  • 38
  • 12
  • 9
  • 9
  • 45
  • 44
  • 18
  • 8
  • 6
  • 3
  • 1
Resistance Gene
  • 50
  • 44
  • 24
  • 5
  • 2
Expression Type
  • 101
  • 51
  • 11
Selectable Marker
  • 29
  • 26
  • 11
  • 1
  • 37
  • 28
  • 28
  • 12
  • 8
  • 56
  • 27
  • 22
  • 22
127 Products

Matrix Metalloproteinase 2 (MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5733626
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
Matrix Metalloproteinase 2 (MMP2)
Gene ID:
337179 (Zebrafish (Danio rerio), MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4054362
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Matrix Metalloproteinase 2 (MMP2)
Gene ID:
81686 (Rat (Rattus), MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4047365
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47
  • RV-M
Catalog No. ABIN4103919
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Matrix Metalloproteinase 2
2-MMP, CG1794, DM2-MMP, Dm2-MMP, Dmel\\CG1794, MMP2, anon-WO0118547.84, dm-2MMP, dmmp2, l(2)02353, mmp2, wu:fa99h12, wu:fk89d01, fgmmp-2, Mmp-2, LOC100135793, Clg4a, GelA, MMP-2, CLG4, CLG4A, MMP-II, MONA, TBE-1
-20 °C
Catalog No. ABIN3188503
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Protein Expression, Cloning
Matrix Metalloproteinase 2 (MMP2)
Gene ID:
337179 (Zebrafish (Danio rerio), MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4054363
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Matrix Metalloproteinase 2 (MMP2)
Gene ID:
81686 (Rat (Rattus), MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4047364
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Matrix Metalloproteinase 2 (MMP2)
Gene ID:
4313 (Human, MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5313608
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Matrix Metalloproteinase 2 (MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4439230
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Matrix Metalloproteinase 2 (MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4621606
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Matrix Metalloproteinase 2 (MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4478135
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Matrix Metalloproteinase 2 (MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4769803
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Matrix Metalloproteinase 2 (MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4706252
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Matrix Metalloproteinase 2 (MMP2)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4835382
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Tavana, Jovic, Mosadegh, Lee, Liu, Luker, Luker, Weiss, Takayama: "Nanolitre liquid patterning in aqueous environments for spatially defined reagent delivery to mammalian cells." in: Nature materials, Vol. 8, Issue 9, pp. 736-41, 2009 (Pubmed)
  • Higashi, Oeda, Yamamoto, Miyazaki: "Identification of amino acid residues of matrix metalloproteinase-7 essential for binding to cholesterol sulfate." in: The Journal of biological chemistry, Vol. 283, Issue 51, pp. 35735-44, 2008 (Pubmed)
Catalog No. ABIN3317862
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MMP2
Viral Particles
-80 °C
Catalog No. ABIN5105829
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
Mouse (Murine)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mmp2
Viral Particles
-80 °C
Catalog No. ABIN5105831
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
Rat (Rattus)
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mmp2
Viral Particles
-80 °C
Catalog No. ABIN5105833
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

RNA Interference
Matrix Metalloproteinase 2
Rat (Rattus)
2-MMP, CG1794, DM2-MMP, Dm2-MMP, Dmel\\CG1794, MMP2, anon-WO0118547.84, dm-2MMP, dmmp2, l(2)02353, mmp2, wu:fa99h12, wu:fk89d01, fgmmp-2, Mmp-2, LOC100135793, Clg4a, GelA, MMP-2, CLG4, CLG4A, MMP-II, MONA, TBE-1
HPLC purified
Available with shipment
  • Mmp2 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3360393
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Matrix Metalloproteinase 2
Mouse (Murine)
2-MMP, CG1794, DM2-MMP, Dm2-MMP, Dmel\\CG1794, MMP2, anon-WO0118547.84, dm-2MMP, dmmp2, l(2)02353, mmp2, wu:fa99h12, wu:fk89d01, fgmmp-2, Mmp-2, LOC100135793, Clg4a, GelA, MMP-2, CLG4, CLG4A, MMP-II, MONA, TBE-1
HPLC purified
Available with shipment
  • Mmp2 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3266360
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to MMP2

  • matrix metallopeptidase 2 (MMP2)
  • Matrix metalloproteinase 2 (Mmp2)
  • matrix metallopeptidase 2 (mmp2)
  • matrix metalloproteinase 2 (LOC657982)
  • matrix metalloproteinase-2 (LOC100135793)
  • matrix metallopeptidase 2 (Mmp2)
  • 2-MMP
  • anon-WO0118547.84
  • CG1794
  • CLG4
  • Clg4a
  • CLG4A
  • dm-2MMP
  • Dm2-MMP
  • DM2-MMP
  • Dmel\\CG1794
  • dmmp2
  • fgmmp-2
  • GelA
  • l(2)02353
  • LOC100135793
  • Mmp-2
  • MMP-2
  • MMP-II
  • MMP2
  • mmp2
  • MONA
  • TBE-1
  • wu:fa99h12
  • wu:fk89d01

Gene-IDs for different species

100033948 Equus caballus
35997 Drosophila melanogaster
337179 Danio rerio
653022 Takifugu rubripes
657982 Tribolium castaneum
100135793 Oncorhynchus mykiss
81686 Rattus norvegicus
17390 Mus musculus
4313 Homo sapiens
282872 Bos taurus
386583 Gallus gallus
403733 Canis lupus familiaris
397391 Sus scrofa
100009000 Oryctolagus cuniculus
443115 Ovis aries

Protein level used designations for MMP2

  • CG1794-PB
  • CG1794-PC
  • CG1794-PD
  • Mmp2-PB
  • Mmp2-PC
  • Mmp2-PD
  • matrix metalloprotease 2
  • matrix metalloproteinase
  • matrix metalloproteinase 2
  • 72 kDa type IV collagenase
  • Gelatinase A
  • matrix metalloproteinase-2
  • 72 kDa gelatinase
  • MMP-2
  • gelatinase A
  • 72kD gelatinase
  • 72kD type IV collagenase
  • 72kDa gelatinase
  • 72kDa type IV collagenase
  • collagenase type IV-A
  • matrix metalloproteinase-II
  • neutrophil gelatinase
  • matrix metalloproteinase 2 (72 KDa type IV collagenase)
  • matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Other products related to MMP2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website