MMP2 (Matrix Metalloproteinase 2, MMP2)

Short Description: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. This gene encodes an enzyme which degrades type IV collagen, the major structural component of basement membranes. The enzyme plays a role in endometrial menstrual breakdown, regulation of vascularization and the inflammatory response. Mutations in this gene have been associated with Winchester syndrome and Nodulosis-Arthropathy-Osteolysis (NAO) syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene MMP2.
Products related to MMP2 Gene:
131 Products
Data Quality
  • 2
  • 1
Type
  • 126
  • 5
Species
  • 66
  • 29
  • 28
  • 2
  • 2
Application
  • 78
  • 31
  • 25
  • 16
  • 1
Fusion tag
  • 49
  • 18
  • 15
  • 11
  • 8
Vector Backbone
  • 11
  • 7
  • 7
  • 6
  • 6
Vector
  • 53
  • 38
  • 12
  • 9
  • 9
Insert
  • 45
  • 44
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 53
  • 44
  • 24
  • 5
  • 2
Expression Type
  • 104
  • 54
  • 11
Selectable Marker
  • 32
  • 26
  • 11
  • 1
Promoter
  • 40
  • 31
  • 28
  • 12
  • 8
Format
  • 60
  • 27
  • 22
  • 22

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Gene ID:
337179 (Zebrafish (Danio rerio), MMP2)
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4054362
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Gene ID:
81686 (Rat (Rattus), MMP2)
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047365
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
NM_004530
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103919
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Matrix Metalloproteinase 2
Species:
Human
Synonyms:
2-MMP, CG1794, DM2-MMP, Dm2-MMP, Dmel\\CG1794, MMP2, anon-WO0118547.84, dm-2MMP, dmmp2, l(2)02353, mmp2, wu:fa99h12, wu:fk89d01, fgmmp-2, Mmp-2, LOC100135793, Clg4a, GelA, MMP-2, CLG4, CLG4A, MMP-II, MONA, TBE-1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188503
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Gene ID:
337179 (Zebrafish (Danio rerio), MMP2)
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4054363
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5733626
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Gene ID:
81686 (Rat (Rattus), MMP2)
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047364
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Gene ID:
4313 (Human, MMP2)
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313608
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
NM_004530,NP_004521
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Tavana, Jovic, Mosadegh, Lee, Liu, Luker, Luker, Weiss, Takayama: "Nanolitre liquid patterning in aqueous environments for spatially defined reagent delivery to mammalian cells." in: Nature materials, Vol. 8, Issue 9, pp. 736-41, 2009 (Pubmed)
  • Higashi, Oeda, Yamamoto, Miyazaki: "Identification of amino acid residues of matrix metalloproteinase-7 essential for binding to cholesterol sulfate." in: The Journal of biological chemistry, Vol. 283, Issue 51, pp. 35735-44, 2008 (Pubmed)
Catalog No. ABIN3317862
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Matrix Metalloproteinase 2 (MMP2)
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478135
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4621606
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4769803
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Matrix Metalloproteinase 2 (MMP2)
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4439230
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4706252
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Matrix Metalloproteinase 2 (MMP2)
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Insert length:
1983 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4835382
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Application:
RNA Interference
Gene:
Matrix Metalloproteinase 2
Species:
Rat (Rattus)
Synonyms:
2-MMP, CG1794, DM2-MMP, Dm2-MMP, Dmel\\CG1794, MMP2, anon-WO0118547.84, dm-2MMP, dmmp2, l(2)02353, mmp2, wu:fa99h12, wu:fk89d01, fgmmp-2, Mmp-2, LOC100135793, Clg4a, GelA, MMP-2, CLG4, CLG4A, MMP-II, MONA, TBE-1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mmp2 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3360393
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Matrix Metalloproteinase 2
Species:
Human
Synonyms:
2-MMP, CG1794, DM2-MMP, Dm2-MMP, Dmel\\CG1794, MMP2, anon-WO0118547.84, dm-2MMP, dmmp2, l(2)02353, mmp2, wu:fa99h12, wu:fk89d01, fgmmp-2, Mmp-2, LOC100135793, Clg4a, GelA, MMP-2, CLG4, CLG4A, MMP-II, MONA, TBE-1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • MMP2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Poudyal, Cui, Le, Hofseth, Windust, Nagarkatti, Nagarkatti, Schetter, Harris, Hofseth: "A key role of microRNA-29b for the suppression of colon cancer cell migration by American ginseng." in: PLoS ONE, Vol. 8, Issue 10, pp. e75034, 2013 (Pubmed)
Catalog No. ABIN3342705
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Matrix Metalloproteinase 2
Species:
Mouse (Murine)
Synonyms:
2-MMP, CG1794, DM2-MMP, Dm2-MMP, Dmel\\CG1794, MMP2, anon-WO0118547.84, dm-2MMP, dmmp2, l(2)02353, mmp2, wu:fa99h12, wu:fk89d01, fgmmp-2, Mmp-2, LOC100135793, Clg4a, GelA, MMP-2, CLG4, CLG4A, MMP-II, MONA, TBE-1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mmp2 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3266360
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
NM_001127891
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MMP2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5105829
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
NM_008610
Species:
Mouse (Murine)
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mmp2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5105831
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to MMP2

  • matrix metallopeptidase 2 (MMP2)
  • Matrix metalloproteinase 2 (Mmp2)
  • matrix metallopeptidase 2 (mmp2)
  • matrix metalloproteinase 2 (LOC657982)
  • matrix metalloproteinase-2 (LOC100135793)
  • matrix metallopeptidase 2 (Mmp2)
  • 2-MMP
  • anon-WO0118547.84
  • CG1794
  • CLG4
  • Clg4a
  • CLG4A
  • dm-2MMP
  • Dm2-MMP
  • DM2-MMP
  • Dmel\\CG1794
  • dmmp2
  • fgmmp-2
  • GelA
  • l(2)02353
  • LOC100135793
  • Mmp-2
  • MMP-2
  • MMP-II
  • MMP2
  • mmp2
  • MONA
  • TBE-1
  • wu:fa99h12
  • wu:fk89d01

Gene-IDs for different species

GENE IDSPECIES
100033948 Equus caballus
35997 Drosophila melanogaster
337179 Danio rerio
653022 Takifugu rubripes
657982 Tribolium castaneum
100135793 Oncorhynchus mykiss
81686 Rattus norvegicus
17390 Mus musculus
4313 Homo sapiens
282872 Bos taurus
386583 Gallus gallus
403733 Canis lupus familiaris
397391 Sus scrofa
100009000 Oryctolagus cuniculus
443115 Ovis aries

Protein level used designations for MMP2

  • CG1794-PB
  • CG1794-PC
  • CG1794-PD
  • Mmp2-PB
  • Mmp2-PC
  • Mmp2-PD
  • matrix metalloprotease 2
  • matrix metalloproteinase
  • matrix metalloproteinase 2
  • 72 kDa type IV collagenase
  • Gelatinase A
  • matrix metalloproteinase-2
  • 72 kDa gelatinase
  • MMP-2
  • gelatinase A
  • 72kD gelatinase
  • 72kD type IV collagenase
  • 72kDa gelatinase
  • 72kDa type IV collagenase
  • collagenase type IV-A
  • matrix metalloproteinase-II
  • neutrophil gelatinase
  • matrix metalloproteinase 2 (72 KDa type IV collagenase)
  • matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Other products related to MMP2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com