MRPL14 (Mitochondrial Ribosomal Protein L14, MRPL14)

Short Description: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found at 17p13.3. [provided by RefSeq, Jul 2008].
More information related to gene MRPL14.
Products related to MRPL14 Gene:
133 Products
Type
  • 130
  • 3
Species
  • 53
  • 42
  • 28
  • 4
  • 4
Application
  • 87
  • 32
  • 24
  • 16
Fusion tag
  • 45
  • 16
  • 13
  • 11
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 65
  • 36
  • 12
  • 9
  • 5
Insert
  • 50
  • 43
  • 21
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 59
  • 47
  • 18
  • 6
  • 2
Expression Type
  • 99
  • 50
  • 26
  • 4
Selectable Marker
  • 26
  • 26
  • 25
  • 1
Promoter
  • 42
  • 32
  • 31
  • 13
  • 8
Format
  • 63
  • 27
  • 22
  • 21

Type:
ORF
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
NCBI Accession:
NM_032111,NP_115487
Species:
Human
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Insert length:
438 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5420014
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
68463 (Mouse (Murine), MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822462
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
64928 (Human, MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819349
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
614579 (Cow (Bovine), MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066997
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
100124892 (Xenopus tropicalis, MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031839
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
100124892 (Xenopus tropicalis, MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031838
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
NCBI Accession:
NM_032111
Species:
Human
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562472
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
NCBI Accession:
NM_026732
Species:
Mouse (Murine)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562473
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Species:
Human
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Insert length:
438 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5746192
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
68463 (Mouse (Murine), MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822463
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
64928 (Human, MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819350
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
614579 (Cow (Bovine), MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066996
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
100124892 (Xenopus tropicalis, MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031837
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
100124892 (Xenopus tropicalis, MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031836
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Gene ID:
64928 (Human, MRPL14)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Insert length:
438 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320487
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
NCBI Accession:
NM_001271131,NP_001258060
Species:
Rat (Rattus)
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Insert length:
438 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3330972
$200.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
NCBI Accession:
NM_032111,NP_115487
Species:
Human
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Insert length:
800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3385204
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Species:
Human
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Insert length:
438 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478218
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Species:
Human
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Insert length:
438 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4621689
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein L14 (MRPL14)
Species:
Human
Synonyms:
mRpL14, MRPL14, LOC552097, LOC100115115, mrpl14, Mrpl14
Insert length:
438 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4769886
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to MRPL14

  • mitochondrial ribosomal protein L14 (mRpL14)
  • mitochondrial ribosomal protein L14 (MRPL14)
  • 39S ribosomal protein L14, mitochondrial (LOC552097)
  • 39S ribosomal protein L14, mitochondrial (LOC100115115)
  • mitochondrial ribosomal protein L14 (mrpl14)
  • mitochondrial ribosomal protein L14 (Mrpl14)
  • 1110006I11Rik
  • AI846816
  • BcDNA:RH18819
  • CG14048
  • Dmel\\CG14048
  • EG:BACH48C10.6
  • GB10521
  • L14
  • L14mt
  • L32mt
  • MRP-L14
  • MRP-L32
  • mRPL14
  • mrpl14.1
  • MRPL32
  • NV10914
  • RMPL32
  • RPML32
  • Rpml32
  • zgc:56531

Gene-IDs for different species

GENE IDSPECIES
31222 Drosophila melanogaster
421443 Gallus gallus
462726 Pan troglodytes
474918 Canis lupus familiaris
552097 Apis mellifera
701827 Macaca mulatta
100115115 Nasonia vitripennis
100124892 Xenopus (Silurana) tropicalis
64928 Homo sapiens
68463 Mus musculus
301250 Rattus norvegicus
614579 Bos taurus
394122 Danio rerio

Protein level used designations for MRPL14

  • CG14048-PA
  • CG14048-PB
  • mRpL14-PA
  • mRpL14-PB
  • mitochondrial ribosomal protein L14
  • mitochondrial ribosomal protein L14.1
  • 39S ribosomal protein L14, mitochondrial
  • 39S ribosomal protein L32, mitochondrial
  • L14mt
  • MRP-L14
  • mitochondrial ribosomal protein L32
Other products related to MRPL14 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com