MRPS26 (Mitochondrial Ribosomal Protein S26, MRPS26)

Short Description: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. This gene lies adjacent to and downstream of the gonadotropin-releasing hormone precursor gene. [provided by RefSeq, Jul 2008].
More information related to gene MRPS26.
Products related to MRPS26 Gene:
116 Products
Type
  • 112
  • 4
Species
  • 43
  • 38
  • 27
  • 4
  • 2
Application
  • 66
  • 29
  • 25
  • 16
Fusion tag
  • 42
  • 16
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 44
  • 36
  • 12
  • 9
  • 8
Insert
  • 40
  • 35
  • 21
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 46
  • 38
  • 22
  • 6
  • 2
Expression Type
  • 91
  • 49
  • 13
  • 4
Selectable Marker
  • 26
  • 24
  • 13
  • 1
Promoter
  • 31
  • 30
  • 25
  • 13
  • 8
Format
  • 48
  • 27
  • 22
  • 19

Type:
ORF
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Species:
Human
Synonyms:
mRpS26, MRPS26, Mrps26
Insert length:
618 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5762500
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
NCBI Accession:
NM_030811,NP_110438
Species:
Human
Synonyms:
mRpS26, MRPS26, Mrps26
Insert length:
618 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5472480
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
436691 (Zebrafish (Danio rerio), MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4075459
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
64949 (Human, MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4092648
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
516004 (Cow (Bovine), MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859694
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
100124861 (Xenopus tropicalis, MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031782
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
100124861 (Xenopus tropicalis, MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031783
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
99045 (Mouse (Murine), MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039505
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
NCBI Accession:
NM_207207
Species:
Mouse (Murine)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562528
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
436691 (Zebrafish (Danio rerio), MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4075460
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
64949 (Human, MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4092647
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
516004 (Cow (Bovine), MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859693
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
100124861 (Xenopus tropicalis, MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031785
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
100124861 (Xenopus tropicalis, MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031784
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
99045 (Mouse (Murine), MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039506
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
Gene ID:
64949 (Human, MRPS26)
Synonyms:
mRpS26, MRPS26, Mrps26
Insert length:
618 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313200
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
NCBI Accession:
NM_207207
Species:
Mouse (Murine)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3957128
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
NCBI Accession:
NM_207207
Species:
Mouse (Murine)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3957123
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
NCBI Accession:
NM_207207
Species:
Mouse (Murine)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3957122
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Mitochondrial Ribosomal Protein S26 (MRPS26)
NCBI Accession:
NM_207207
Species:
Mouse (Murine)
Synonyms:
mRpS26, MRPS26, Mrps26
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3957119
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to MRPS26

  • mitochondrial ribosomal protein S26 (mRpS26)
  • mitochondrial ribosomal protein S26 (MRPS26)
  • mitochondrial ribosomal protein S26 (Mrps26)
  • AI648866
  • C20orf193
  • CG7354
  • dJ534B8.3
  • Dmel\\CG7354
  • GI008
  • MRP-S13
  • MRP-S26
  • MRPS13
  • NY-BR-87
  • RPMS13
  • Rpms13

Gene-IDs for different species

GENE IDSPECIES
40001 Drosophila melanogaster
64949 Homo sapiens
99045 Mus musculus
516004 Bos taurus
362216 Rattus norvegicus

Protein level used designations for MRPS26

  • CG7354-PA
  • mRpS26-PA
  • 28S ribosomal protein S13, mitochondrial
  • 28S ribosomal protein S26, mitochondrial
  • S13mt
  • S26mt
  • serologically defined breast cancer antigen NY-BR-87
  • MRP-S26
  • 5'OT-EST protein
  • protein 5'OT-EST
Other products related to MRPS26 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com