Myeloperoxidase (Myeloperoxidase, MPO)

Short Description: Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of netrophils. [provided by RefSeq, Jul 2008].
More information related to gene Myeloperoxidase.
Products related to Myeloperoxidase Gene:
98 Products
Data Quality
  • 1
Type
  • 94
  • 4
Species
  • 38
  • 28
  • 26
  • 4
  • 2
Application
  • 48
  • 26
  • 23
  • 16
  • 1
Fusion tag
  • 37
  • 15
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 35
  • 25
  • 12
  • 11
  • 9
Insert
  • 36
  • 22
  • 20
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 39
  • 32
  • 18
  • 5
  • 2
Expression Type
  • 85
  • 48
  • 1
Selectable Marker
  • 29
  • 26
  • 1
Promoter
  • 30
  • 30
  • 13
  • 8
  • 7
Format
  • 34
  • 27
  • 22
  • 15

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
511206 (Cow (Bovine), MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3857328
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
4353 (Human, MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999782
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
394386 (Xenopus laevis, MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4019079
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
17523 (Mouse (Murine), MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096547
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
394386 (Xenopus laevis, MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4019080
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
Quantitative real-time PCR
Gene:
Myeloperoxidase
Species:
Human
Synonyms:
mKIAA4033, MPO, LOC100335032, POX2', XPOX2', mpo, mpo-A, pmr-1, pmr1, pox2, xpox2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193010
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
394386 (Xenopus laevis, MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4019077
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
4353 (Human, MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3999781
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
394386 (Xenopus laevis, MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4019078
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
17523 (Mouse (Murine), MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096548
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
511206 (Cow (Bovine), MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3857327
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Myeloperoxidase (MPO)
Gene ID:
4353 (Human, MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Insert length:
2238 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324442
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Myeloperoxidase (MPO)
Gene ID:
4353 (Human, MPO)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3428355
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Myeloperoxidase (MPO)
NCBI Accession:
NM_000250,NP_000241
Species:
Human
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Insert length:
2238 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5357028
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myeloperoxidase (MPO)
NCBI Accession:
NM_000250
Species:
Human
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MPO
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5093194
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myeloperoxidase (MPO)
NCBI Accession:
NM_010824
Species:
Mouse (Murine)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mpo
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5093196
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myeloperoxidase (MPO)
NCBI Accession:
NM_001107036
Species:
Rat (Rattus)
Synonyms:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mpo
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5093198
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Application:
RNA Interference
Gene:
Myeloperoxidase
Species:
Human
Synonyms:
mKIAA4033, MPO, LOC100335032, POX2', XPOX2', mpo, mpo-A, pmr-1, pmr1, pox2, xpox2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • MPO (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Miyahara, Nishikawa, Takeuchi, Yasuda, Okamoto, Kawano, Horiuchi: "Effect of myeloperoxidase inhibition on gene expression profiles in HL-60 cells exposed to 1,2,4,-benzenetriol." in: Toxicology, Vol. 317, Issue , pp. 50-7, 2014 (Pubmed)
Catalog No. ABIN3342734
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Myeloperoxidase
Species:
Rat (Rattus)
Synonyms:
mKIAA4033, MPO, LOC100335032, POX2', XPOX2', mpo, mpo-A, pmr-1, pmr1, pox2, xpox2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mpo (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3357994
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Myeloperoxidase
Species:
Mouse (Murine)
Synonyms:
mKIAA4033, MPO, LOC100335032, POX2', XPOX2', mpo, mpo-A, pmr-1, pmr1, pox2, xpox2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Mpo (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3262677
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to Myeloperoxidase

  • myeloperoxidase (MPO)
  • myeloperoxidase (Mpo)
  • myeloperoxidase (LOC100335032)
  • myeloperoxidase L homeolog (mpo.L)
  • LOC100335032
  • mKIAA4033
  • MPO
  • mpo
  • mpo-A
  • pmr-1
  • pmr1
  • pox2
  • POX2'
  • xpox2
  • XPOX2'

Gene-IDs for different species

GENE IDSPECIES
4353 Homo sapiens
17523 Mus musculus
303413 Rattus norvegicus
417467 Gallus gallus
511206 Bos taurus
609986 Canis lupus familiaris
714246 Macaca mulatta
748680 Pan troglodytes
100070920 Equus caballus
100142673 Felis catus
100335032 Ictalurus punctatus
100340692 Oryctolagus cuniculus
100461693 Pongo abelii
100472895 Ailuropoda melanoleuca
100517120 Sus scrofa
100606582 Nomascus leucogenys
100725291 Cavia porcellus
101123053 Ovis aries
394386 Xenopus laevis

Protein level used designations for Myeloperoxidase

  • myeloperoxidase
  • myeloperoxidase-like
  • myeloperoxidase, peroxidase 2'
Other products related to Myeloperoxidase such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com