Myeloperoxidase (Myeloperoxidase, MPO)

Short Description: Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of netrophils. [provided by RefSeq, Jul 2008].
More information related to gene Myeloperoxidase.
Products related to Myeloperoxidase Gene:
98 Products
Data Quality
  • 1
  • 94
  • 4
  • 38
  • 28
  • 26
  • 4
  • 2
  • 48
  • 26
  • 23
  • 16
  • 1
Fusion tag
  • 37
  • 15
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 35
  • 25
  • 12
  • 11
  • 9
  • 36
  • 22
  • 20
  • 8
  • 6
  • 3
  • 1
Resistance Gene
  • 39
  • 32
  • 18
  • 5
  • 2
Expression Type
  • 85
  • 48
  • 1
Selectable Marker
  • 29
  • 26
  • 1
  • 30
  • 30
  • 13
  • 8
  • 7
  • 34
  • 27
  • 22
  • 15

Protein Expression, Cloning
Myeloperoxidase (MPO)
Gene ID:
511206 (Cow (Bovine), MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3857328
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Myeloperoxidase (MPO)
Gene ID:
17523 (Mouse (Murine), MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4096547
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Myeloperoxidase (MPO)
Gene ID:
4353 (Human, MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3999782
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Myeloperoxidase (MPO)
Gene ID:
394386 (Xenopus laevis, MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4019079
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Myeloperoxidase (MPO)
Gene ID:
394386 (Xenopus laevis, MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4019080
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Quantitative real-time PCR
mKIAA4033, MPO, LOC100335032, POX2', XPOX2', mpo, mpo-A, pmr-1, pmr1, pox2, xpox2
-20 °C
Catalog No. ABIN3193010
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Protein Expression, Cloning
Myeloperoxidase (MPO)
Gene ID:
511206 (Cow (Bovine), MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3857327
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Myeloperoxidase (MPO)
Gene ID:
17523 (Mouse (Murine), MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4096548
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Myeloperoxidase (MPO)
Gene ID:
4353 (Human, MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3999781
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Myeloperoxidase (MPO)
Gene ID:
394386 (Xenopus laevis, MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4019077
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Myeloperoxidase (MPO)
Gene ID:
394386 (Xenopus laevis, MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4019078
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Myeloperoxidase (MPO)
Gene ID:
4353 (Human, MPO)
MPO, Mpo, LOC100335032, mpo.L
Insert length:
2238 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5324442
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Myeloperoxidase (MPO)
Gene ID:
4353 (Human, MPO)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3428355
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Myeloperoxidase (MPO)
NCBI Accession:
MPO, Mpo, LOC100335032, mpo.L
Insert length:
2238 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5357028
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

RNA Interference
Mouse (Murine)
mKIAA4033, MPO, LOC100335032, POX2', XPOX2', mpo, mpo-A, pmr-1, pmr1, pox2, xpox2
HPLC purified
Available with shipment
  • Mpo (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3262677
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

RNA Interference
mKIAA4033, MPO, LOC100335032, POX2', XPOX2', mpo, mpo-A, pmr-1, pmr1, pox2, xpox2
HPLC purified
Available with shipment
  • MPO (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
  • Miyahara, Nishikawa, Takeuchi, Yasuda, Okamoto, Kawano, Horiuchi: "Effect of myeloperoxidase inhibition on gene expression profiles in HL-60 cells exposed to 1,2,4,-benzenetriol." in: Toxicology, Vol. 317, Issue , pp. 50-7, 2014 (Pubmed)
Catalog No. ABIN3342734
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

RNA Interference
Rat (Rattus)
mKIAA4033, MPO, LOC100335032, POX2', XPOX2', mpo, mpo-A, pmr-1, pmr1, pox2, xpox2
HPLC purified
Available with shipment
  • Mpo (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3357994
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Myeloperoxidase (MPO)
NCBI Accession:
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MPO
Viral Particles
-80 °C
Catalog No. ABIN5093194
300 μL
Plus shipping costs $45.00 and $22.60 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Myeloperoxidase (MPO)
NCBI Accession:
Mouse (Murine)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mpo
Viral Particles
-80 °C
Catalog No. ABIN5093196
300 μL
Plus shipping costs $45.00 and $22.60 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Myeloperoxidase (MPO)
NCBI Accession:
Rat (Rattus)
MPO, Mpo, LOC100335032, mpo.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Mpo
Viral Particles
-80 °C
Catalog No. ABIN5093198
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
  • <
  • 1

Synonyms and alternative names related to Myeloperoxidase

  • myeloperoxidase (MPO)
  • myeloperoxidase (Mpo)
  • myeloperoxidase (LOC100335032)
  • myeloperoxidase L homeolog (mpo.L)
  • LOC100335032
  • mKIAA4033
  • MPO
  • mpo
  • mpo-A
  • pmr-1
  • pmr1
  • pox2
  • POX2'
  • xpox2
  • XPOX2'

Gene-IDs for different species

4353 Homo sapiens
17523 Mus musculus
303413 Rattus norvegicus
417467 Gallus gallus
511206 Bos taurus
609986 Canis lupus familiaris
714246 Macaca mulatta
748680 Pan troglodytes
100070920 Equus caballus
100142673 Felis catus
100335032 Ictalurus punctatus
100340692 Oryctolagus cuniculus
100461693 Pongo abelii
100472895 Ailuropoda melanoleuca
100517120 Sus scrofa
100606582 Nomascus leucogenys
100725291 Cavia porcellus
101123053 Ovis aries
394386 Xenopus laevis

Protein level used designations for Myeloperoxidase

  • myeloperoxidase
  • myeloperoxidase-like
  • myeloperoxidase, peroxidase 2'
Other products related to Myeloperoxidase such as antibodies, ELISA kits and high-purity proteins are available on our partner website