N-Cadherin (Cadherin 2, CDH2)

Short Description: This gene is a classical cadherin from the cadherin superfamily. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. The protein functions during gastrulation and is required for establishment of left-right asymmetry. At certain central nervous system synapses, presynaptic to postsynaptic adhesion is mediated at least in part by this gene product. [provided by RefSeq, Jul 2008].
More information related to gene N-Cadherin.
Products related to N-Cadherin Gene:
127 Products
Data Quality
  • 1
  • 1
Type
  • 118
  • 9
Species
  • 52
  • 42
  • 29
  • 2
  • 2
Application
  • 72
  • 27
  • 27
  • 16
  • 3
Fusion tag
  • 44
  • 16
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 51
  • 35
  • 12
  • 9
  • 5
Insert
  • 45
  • 36
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 3
Resistance Gene
  • 54
  • 42
  • 18
  • 4
  • 2
Expression Type
  • 88
  • 50
  • 22
Selectable Marker
  • 26
  • 24
  • 22
Promoter
  • 32
  • 31
  • 31
  • 12
  • 8
Format
  • 64
  • 27
  • 22
  • 14

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cadherin 2 (CDH2)
Gene ID:
30291 (Zebrafish (Danio rerio), CDH2)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875707
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cadherin 2 (CDH2)
Gene ID:
12558 (Mouse (Murine), CDH2)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807993
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cadherin 2 (CDH2)
Gene ID:
100151712 (Xenopus tropicalis, CDH2)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874014
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cadherin 2 (CDH2)
Gene ID:
1000 (Human, CDH2)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210823
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cadherin 2 (CDH2)
NCBI Accession:
NM_031333
Species:
Rat (Rattus)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887733
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cadherin 2 (CDH2)
NCBI Accession:
NM_001792
Species:
Human
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887732
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cadherin 2 (CDH2)
NCBI Accession:
NM_007664
Species:
Mouse (Murine)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558362
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Cadherin 2
NCBI Accession:
NM_001792
Species:
Human
Synonyms:
CD325, CDHN, CDw325, NCAD, N-cadherin, cadherin-2, cdhn, ncad, cdw325, CDH2, Cadherin-2, Ncad, glo, lyr, pac, wu:fb47h04
PCR Size:
116 bp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188353
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Cadherin 2
Species:
Mouse (Murine)
Synonyms:
CD325, CDHN, CDw325, NCAD, N-cadherin, cadherin-2, cdhn, ncad, cdw325, CDH2, Cadherin-2, Ncad, glo, lyr, pac, wu:fb47h04
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194283
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Cadherin 2
Species:
Rat (Rattus)
Synonyms:
CD325, CDHN, CDw325, NCAD, N-cadherin, cadherin-2, cdhn, ncad, cdw325, CDH2, Cadherin-2, Ncad, glo, lyr, pac, wu:fb47h04
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196420
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cadherin 2 (CDH2)
Gene ID:
30291 (Zebrafish (Danio rerio), CDH2)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3813681
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Cadherin 2 (CDH2)
Species:
Human
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Insert length:
2721 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5733273
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cadherin 2 (CDH2)
Gene ID:
12558 (Mouse (Murine), CDH2)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807994
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cadherin 2 (CDH2)
Gene ID:
100151712 (Xenopus tropicalis, CDH2)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874013
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cadherin 2 (CDH2)
Gene ID:
1000 (Human, CDH2)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210822
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Cadherin 2 (CDH2)
Gene ID:
1000 (Human, CDH2)
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Insert length:
2721 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5319849
$214.67
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Cadherin 2 (CDH2)
NCBI Accession:
NM_001792,NP_001783
Species:
Human
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Insert length:
4500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, SP6 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948185

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Diamond, Sun, Ottaviano, Joseph, Munshi: "Differential growth factor regulation of N-cadherin expression and motility in normal and malignant oral epithelium." in: Journal of cell science, Vol. 121, Issue Pt 13, pp. 2197-207, 2008 (Pubmed)
Catalog No. ABIN3393417
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Cadherin 2 (CDH2)
Species:
Human
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Insert length:
2721 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4473815
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Cadherin 2 (CDH2)
Species:
Human
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Insert length:
2721 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4500834
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cadherin 2 (CDH2)
Species:
Human
Synonyms:
CDH2, cdh2.S, cdh2, Cdh2
Insert length:
2721 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4699626
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to N-Cadherin

  • cadherin 2 (CDH2)
  • cadherin 2 S homeolog (cdh2.S)
  • cadherin 2 (cdh2)
  • cadherin 2 (Cdh2)
  • cadherin 2, type 1, N-cadherin (neuronal) (cdh2)
  • cadherin 2, type 1, N-cadherin (neuronal) (CDH2)
  • Cadherin-2
  • cadherin-2
  • CD325
  • CDH2
  • CDHN
  • cdhn
  • CDw325
  • cdw325
  • glo
  • lyr
  • N-cadherin
  • NCAD
  • ncad
  • Ncad
  • pac
  • wu:fb47h04

Gene-IDs for different species

GENE IDSPECIES
1000 Homo sapiens
495284 Xenopus laevis
100151712 Xenopus (Silurana) tropicalis
100411112 Callithrix jacchus
12558 Mus musculus
83501 Rattus norvegicus
480169 Canis lupus familiaris
281062 Bos taurus
414745 Gallus gallus
30291 Danio rerio
100689204 Cricetulus griseus
100286861 Sus scrofa
101082701 Felis catus
100065078 Equus caballus
100170321 Ovis aries
100328895 Oryctolagus cuniculus
100714783 Cavia porcellus

Protein level used designations for N-Cadherin

  • N-cadherin 1
  • cadherin 2, N-cadherin (neuronal)
  • cadherin-2
  • calcium-dependent adhesion protein, neuronal
  • neural cadherin
  • neural-cadherin
  • cadherin 2, type 1, N-cadherin (neuronal)
  • cadherin-2-like
  • Neural cadherin
  • cadherin 2, type 1 preproprotein
  • cadherin 2 type 1 N-cadherin (neuronal)
  • N-cadherin
  • glass onion
  • labyrinth
  • n-cadherin
  • parachute
Other products related to N-Cadherin such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com