NBPF3 (Neuroblastoma Breakpoint Family, Member 3, NBPF3)

Short Description: This gene is a member of the neuroblastoma breakpoint family (NBPF) which consists of dozens of recently duplicated genes primarily located in segmental duplications on human chromosome 1. This gene family has experienced its greatest expansion within the human lineage and has expanded, to a lesser extent, among primates in general. Members of this gene family are characterized by tandemly repeated copies of DUF1220 protein domains. DUF1220 copy number variations in human chromosomal region 1q21.1, where most DUF1220 domains are located, have been implicated in a number of developmental and neurogenetic diseases such as microcephaly, macrocephaly, autism, schizophrenia, mental retardation, congenital heart disease, neuroblastoma, and congenital kidney and urinary tract anomalies. Altered expression of some gene family members is associated with several types of cancer. This gene family contains numerous pseudogenes. [provided by RefSeq, Feb 2013].
More information related to gene NBPF3.
Products related to NBPF3 Gene:
41 Products
  • 40
  • 1
  • 41
  • 22
  • 8
  • 8
  • 7
Fusion tag
  • 13
  • 7
  • 5
  • 4
  • 3
Vector Backbone
  • 3
  • 3
  • 2
  • 2
  • 2
  • 13
  • 12
  • 6
  • 3
  • 3
  • 13
  • 13
  • 7
  • 3
  • 2
  • 1
Resistance Gene
  • 17
  • 16
  • 4
  • 3
  • 2
Expression Type
  • 35
  • 21
Selectable Marker
  • 10
  • 10
  • 1
  • 13
  • 12
  • 7
  • 4
  • 3
  • 17
  • 11
  • 7
  • 6

Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
NCBI Accession:
Insert length:
1902 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5473538
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Gene ID:
84224 (Human, NBPF3)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4213435
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Insert length:
1017 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5762863
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Gene ID:
84224 (Human, NBPF3)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4213434
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Gene ID:
84224 (Human, NBPF3)
Insert length:
1017 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5316555
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Insert length:
1017 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4478513
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Insert length:
1017 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4621984
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Insert length:
1017 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4770181
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Insert length:
1017 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4439608
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Insert length:
1017 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4706785
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Insert length:
1017 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4835915
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5773476
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5773475
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Gene ID:
84224 (Human, NBPF3)
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • pDONR201-forward
Glycerol Stock
-80 °C
Catalog No. ABIN3407576
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Gene ID:
84224 (Human, NBPF3)
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3396504
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

RNA Interference
Neuroblastoma Breakpoint Family, Member 3
HPLC purified
Available with shipment
  • NBPF3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3310411
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
NCBI Accession:
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of NBPF3
Viral Particles
-80 °C
Catalog No. ABIN5162072
300 μL
Plus shipping costs $45.00 and $22.60 dry ice

Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Gene ID:
84224 (Human, NBPF3)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Stable, Transient

Sequencing Primer:
  • 3-1291
Glycerol Stock
-80 °C
Catalog No. ABIN3403926
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Gene ID:
84224 (Human, NBPF3)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5044642
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Neuroblastoma Breakpoint Family, Member 3 (NBPF3)
Insert length:
1017 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4508024
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to NBPF3

  • NBPF member 3 (NBPF3)
  • AE2

Gene-IDs for different species

84224 Homo sapiens

Protein level used designations for NBPF3

  • neuroblastoma breakpoint family member 3
  • protein SHIIIa4
Other products related to NBPF3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com