PKD1L2 (Polycystic Kidney Disease 1-Like 2, PKD1L2)

Short Description: This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene PKD1L2.
Products related to PKD1L2 Gene:
79 Products
Type
  • 76
  • 3
Species
  • 56
  • 23
Application
  • 46
  • 16
  • 12
  • 12
  • 1
Fusion tag
  • 26
  • 9
  • 8
  • 6
  • 6
Vector Backbone
  • 6
  • 4
  • 4
  • 4
  • 4
Vector
  • 36
  • 19
  • 8
  • 6
  • 4
Insert
  • 28
  • 22
  • 14
  • 6
  • 4
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 36
  • 28
  • 6
  • 6
  • 2
Expression Type
  • 60
  • 39
  • 11
Selectable Marker
  • 24
  • 18
  • 11
  • 1
Promoter
  • 22
  • 20
  • 19
  • 9
  • 6
Format
  • 43
  • 18
  • 11
  • 7

Type:
ORF
Application:
Cloning
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Insert length:
921 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5757149
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3563518
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Polycystic Kidney Disease 1-Like 2
Species:
Human
Synonyms:
1700126L06Rik, PC1L2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190244
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Gene ID:
114780 (Human, PKD1L2)
Synonyms:
Pkd1l2, PKD1L2
Insert length:
921 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316270
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Insert length:
921 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4440557
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4708482
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4837612
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4622933
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Insert length:
921 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4479462
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4771130
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Gene ID:
114780 (Human, PKD1L2)
Synonyms:
Pkd1l2, PKD1L2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3430146
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Gene ID:
114780 (Human, PKD1L2)
Synonyms:
Pkd1l2, PKD1L2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3395751
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Gene ID:
114780 (Human, PKD1L2)
Synonyms:
Pkd1l2, PKD1L2
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3417794
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
NCBI Accession:
NM_001278423,NP_001265352
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3364605
$320.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
NCBI Accession:
NM_001076780
Species:
Human
Synonyms:
Pkd1l2, PKD1L2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of PKD1L2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5151131
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
NCBI Accession:
NM_029686
Species:
Mouse (Murine)
Synonyms:
Pkd1l2, PKD1L2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Pkd1l2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5151133
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
Polycystic Kidney Disease 1-Like 2
Species:
Human
Synonyms:
1700126L06Rik, PC1L2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • PKD1L2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3311427
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Polycystic Kidney Disease 1-Like 2
Species:
Mouse (Murine)
Synonyms:
1700126L06Rik, PC1L2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Pkd1l2 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3350344
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Gene ID:
114780 (Human, PKD1L2)
Synonyms:
Pkd1l2, PKD1L2
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Resistance Gene:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3405613
$458.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Polycystic Kidney Disease 1-Like 2 (PKD1L2)
Gene ID:
114780 (Human, PKD1L2)
Synonyms:
Pkd1l2, PKD1L2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5048419

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5029474
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to PKD1L2

  • polycystic kidney disease 1 like 2 (Pkd1l2)
  • polycystin 1 like 2 (gene/pseudogene) (PKD1L2)
  • 1700126L06Rik
  • PC1L2

Gene-IDs for different species

GENE IDSPECIES
76645 Mus musculus
114780 Homo sapiens

Protein level used designations for PKD1L2

  • PC1-like 2 protein
  • polycystic kidney disease 1-like 2
  • polycystic kidney disease protein 1-like 2
  • polycystin-1L2
Other products related to PKD1L2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com