POMZP3 (POM121 and ZP3 Fusion, POMZP3)

Short Description: This gene appears to have resulted from a fusion of DNA sequences derived from 2 distinct loci, specifically through the duplication of two internal exons from the POM121 gene and four 3' exons from the ZP3 gene. The 5' end of this gene is similar to the 5` coding region of the POM121 gene which encodes an integral nuclear pore membrane protein. However, the protein encoded by this gene lacks the nuclear pore localization motif. The 3' end of this gene is similar to the last 4 exons of the zona pellucida glycoprotein 3 (ZP3) gene and the encoded protein retains one zona pellucida domain. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008].
More information related to gene POMZP3.
Products related to POMZP3 Gene:
44 Products
  • 43
  • 1
  • 44
  • 27
  • 8
  • 7
  • 6
Fusion tag
  • 12
  • 8
  • 6
  • 4
  • 3
Vector Backbone
  • 3
  • 3
  • 2
  • 2
  • 2
  • 16
  • 13
  • 6
  • 4
  • 3
  • 18
  • 11
  • 7
  • 3
  • 2
  • 1
Resistance Gene
  • 16
  • 14
  • 8
  • 5
  • 2
Expression Type
  • 39
  • 22
Selectable Marker
  • 11
  • 10
  • 1
  • 17
  • 12
  • 7
  • 4
  • 3
  • 19
  • 11
  • 8
  • 6

POM121 and ZP3 Fusion (POMZP3)
Insert length:
633 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5751592
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
ISO 9001:2008

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
Gene ID:
22932 (Human, POMZP3)
Insert length:
348 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4936463
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

POM121 and ZP3 Fusion (POMZP3)
Gene ID:
22932 (Human, POMZP3)
Insert length:
633 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5323309
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
Gene ID:
22932 (Human, POMZP3)
Insert length:
564 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4925264
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
Insert length:
633 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4414552
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

POM121 and ZP3 Fusion (POMZP3)
Insert length:
633 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4708766
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

POM121 and ZP3 Fusion (POMZP3)
Insert length:
633 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4837896
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

POM121 and ZP3 Fusion (POMZP3)
Insert length:
633 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4623108
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
Insert length:
633 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4479637
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

POM121 and ZP3 Fusion (POMZP3)
Insert length:
633 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4771305
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5773022
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5773021
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
Gene ID:
22932 (Human, POMZP3)
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3396050
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
Gene ID:
22932 (Human, POMZP3)
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3416567
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
Gene ID:
22932 (Human, POMZP3)
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3416193
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
Insert length:
633 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5437778
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
Insert length:
348 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5437779
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Protein Expression
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
Insert length:
1340 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3385943
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of POMZP3
Viral Particles
-80 °C
Catalog No. ABIN5140160
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

RNA Interference
POM121 and ZP3 Fusion
HPLC purified
Available with shipment
  • POMZP3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3283928
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to POMZP3

  • POM121 and ZP3 fusion (POMZP3)
  • POM-ZP3
  • POM121

Gene-IDs for different species

22932 Homo sapiens

Protein level used designations for POMZP3

  • POM (POM121 homolog, rat) and ZP3 fusion
  • POM (POM121 rat homolog) and ZP3 fusion
  • POM-ZP3 fusion protein
  • POM121 and ZP3 fusion protein
  • POM121/ZP3 fusion protein
Other products related to POMZP3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com