POMZP3 (POM121 and ZP3 Fusion, POMZP3)

Short Description: This gene appears to have resulted from a fusion of DNA sequences derived from 2 distinct loci, specifically through the duplication of two internal exons from the POM121 gene and four 3' exons from the ZP3 gene. The 5' end of this gene is similar to the 5` coding region of the POM121 gene which encodes an integral nuclear pore membrane protein. However, the protein encoded by this gene lacks the nuclear pore localization motif. The 3' end of this gene is similar to the last 4 exons of the zona pellucida glycoprotein 3 (ZP3) gene and the encoded protein retains one zona pellucida domain. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008].
More information related to gene POMZP3.
Products related to POMZP3 Gene:
Type
  • 42
  • 1
Species
  • 43
Application
  • 27
  • 7
  • 7
  • 6
Fusion tag
  • 12
  • 7
  • 6
  • 4
  • 3
Vector Backbone
  • 3
  • 3
  • 2
  • 2
  • 2
Vector
  • 16
  • 12
  • 6
  • 4
  • 3
Insert
  • 18
  • 11
  • 6
  • 3
  • 2
Oligo-Type
  • 1
Resistance Gene
  • 16
  • 13
  • 8
  • 5
  • 2
Expression Type
  • 38
  • 21
Selectable Marker
  • 10
  • 10
  • 1
Promoter
  • 16
  • 11
  • 7
  • 4
  • 3
Format
  • 18
  • 11
  • 8
  • 6
43 Products

Type:
ORF
Application:
Cloning
Gene:
POM121 and ZP3 Fusion (POMZP3)
Species:
Human
Synonyms:
POMZP3
Insert length:
633 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751592
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
NM_152992
Gene ID:
22932 (Human, POMZP3)
Synonyms:
POMZP3
Insert length:
348 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4936463
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
ORF
Application:
Cloning
Gene:
POM121 and ZP3 Fusion (POMZP3)
Gene ID:
22932 (Human, POMZP3)
Synonyms:
POMZP3
Insert length:
633 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323309
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
NM_012230
Gene ID:
22932 (Human, POMZP3)
Synonyms:
POMZP3
Insert length:
564 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4925264
$269.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
POM121 and ZP3 Fusion (POMZP3)
Species:
Human
Synonyms:
POMZP3
Insert length:
633 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4708766
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
POM121 and ZP3 Fusion (POMZP3)
Species:
Human
Synonyms:
POMZP3
Insert length:
633 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4837896
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
Species:
Human
Synonyms:
POMZP3
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5773022
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
Species:
Human
Synonyms:
POMZP3
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5773021
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
Species:
Human
Synonyms:
POMZP3
Insert length:
633 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4414552
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
POM121 and ZP3 Fusion (POMZP3)
Species:
Human
Synonyms:
POMZP3
Insert length:
633 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4771305
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
POM121 and ZP3 Fusion (POMZP3)
Species:
Human
Synonyms:
POMZP3
Insert length:
633 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4623108
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
Species:
Human
Synonyms:
POMZP3
Insert length:
633 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4479637
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
Gene ID:
22932 (Human, POMZP3)
Synonyms:
POMZP3
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3396050
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
Gene ID:
22932 (Human, POMZP3)
Synonyms:
POMZP3
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3416193
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
Gene ID:
22932 (Human, POMZP3)
Synonyms:
POMZP3
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3416567
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
NM_012230,NP_036362
Species:
Human
Synonyms:
POMZP3
Insert length:
1340 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3385943
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
NM_152992,NP_694537
Species:
Human
Synonyms:
POMZP3
Insert length:
348 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5437779
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
NM_012230,NP_036362
Species:
Human
Synonyms:
POMZP3
Insert length:
633 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5437778
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
POM121 and ZP3 Fusion (POMZP3)
NCBI Accession:
NM_152992
Species:
Human
Synonyms:
POMZP3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of POMZP3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5140160
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
POM121 and ZP3 Fusion
Species:
Human
Synonyms:
POM-ZP3, POM121
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • POMZP3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3283928
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to POMZP3

  • POM121 and ZP3 fusion (POMZP3)
  • POM-ZP3
  • POM121

Gene-IDs for different species

GENE IDSPECIES
22932 Homo sapiens

Protein level used designations for POMZP3

  • POM (POM121 homolog, rat) and ZP3 fusion
  • POM (POM121 rat homolog) and ZP3 fusion
  • POM-ZP3 fusion protein
  • POM121 and ZP3 fusion protein
  • POM121/ZP3 fusion protein
Other products related to POMZP3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com