RAMP1 (Receptor (G Protein-Coupled) Activity Modifying Protein 1, RAMP1)

Short Description: The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP1) protein, CRLR functions as a CGRP receptor. The RAMP1 protein is involved in the terminal glycosylation, maturation, and presentation of the CGRP receptor to the cell surface. [provided by RefSeq, Jul 2008].
More information related to gene RAMP1.
Products related to RAMP1 Gene:
146 Products
Type
  • 140
  • 6
Species
  • 55
  • 54
  • 27
  • 6
  • 2
Application
  • 80
  • 41
  • 26
  • 16
  • 1
Fusion tag
  • 48
  • 20
  • 17
  • 14
  • 8
Vector Backbone
  • 10
  • 10
  • 6
  • 6
  • 6
Vector
  • 49
  • 44
  • 20
  • 13
  • 9
Insert
  • 57
  • 46
  • 21
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 61
  • 42
  • 30
  • 7
  • 2
Expression Type
  • 116
  • 59
  • 11
  • 2
Selectable Marker
  • 37
  • 26
  • 11
  • 1
Promoter
  • 48
  • 31
  • 22
  • 21
  • 8
Format
  • 53
  • 45
  • 26
  • 22

Type:
ORF
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Species:
Human
Synonyms:
RAMP1, ramp1, Ramp1
Insert length:
447 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5757307
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
NCBI Accession:
NM_005855,NP_005846
Species:
Human
Synonyms:
RAMP1, ramp1, Ramp1
Insert length:
447 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5456435
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
100007315 (Zebrafish (Danio rerio), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4025610
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
100007315 (Zebrafish (Danio rerio), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4025611
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
100007315 (Zebrafish (Danio rerio), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4044691
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
51801 (Mouse (Murine), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3814736
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
617017 (Cow (Bovine), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3867279
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
10267 (Human, RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088786
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Species:
Human
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3642691
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1
Species:
Human
Synonyms:
RAMP1, MGC147096, 9130218E19Rik
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190341
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
100007315 (Zebrafish (Danio rerio), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4025608
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
100007315 (Zebrafish (Danio rerio), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4025609
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
100007315 (Zebrafish (Danio rerio), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4044690
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
51801 (Mouse (Murine), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3814738
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
617017 (Cow (Bovine), RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3867277
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
10267 (Human, RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088785
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Gene ID:
10267 (Human, RAMP1)
Synonyms:
RAMP1, ramp1, Ramp1
Insert length:
447 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313049
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Species:
Human
Synonyms:
RAMP1, ramp1, Ramp1
Insert length:
447 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4415075
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Species:
Human
Synonyms:
RAMP1, ramp1, Ramp1
Insert length:
447 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4480161
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Receptor (G Protein-Coupled) Activity Modifying Protein 1 (RAMP1)
Species:
Human
Synonyms:
RAMP1, ramp1, Ramp1
Insert length:
447 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4623632
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to RAMP1

  • receptor activity modifying protein 1 (RAMP1)
  • receptor (G protein-coupled) activity modifying protein 1 (ramp1)
  • receptor (calcitonin) activity modifying protein 1 (Ramp1)
  • receptor activity modifying protein 1 (Ramp1)
  • 9130218E19Rik
  • MGC147096
  • RAMP1

Gene-IDs for different species

GENE IDSPECIES
424016 Gallus gallus
460053 Pan troglodytes
574329 Macaca mulatta
607163 Canis lupus familiaris
617017 Bos taurus
780274 Xenopus (Silurana) tropicalis
51801 Mus musculus
100135610 Cavia porcellus
58965 Rattus norvegicus
10267 Homo sapiens
397401 Sus scrofa

Protein level used designations for RAMP1

  • receptor (calcitonin) activity modifying protein 1
  • receptor activity-modifying protein 1
  • receptor activity modifying protein 1
  • receptor (G protein-coupled) activity modifying protein 1
  • CRLR activity-modifying protein 1
  • calcitonin receptor-like receptor activity modifying protein 1
  • calcitonin-receptor-like receptor activity-modifying protein 1
Other products related to RAMP1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com