RPS19BP1 (Ribosomal Protein S19 Binding Protein 1, RPS19BP1)

Short Description: Direct regulator of SIRT1. Enhances SIRT1-mediated deacetylation of p53/TP53, thereby participating in inhibition of p53/TP53-mediated transcriptional activity (By similarity).
More information related to gene RPS19BP1.
Products related to RPS19BP1 Gene:
Type
  • 86
  • 3
Species
  • 38
  • 26
  • 23
  • 1
  • 1
Application
  • 48
  • 21
  • 21
  • 12
Fusion tag
  • 29
  • 13
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 4
  • 4
Vector
  • 32
  • 25
  • 12
  • 9
  • 4
Insert
  • 32
  • 24
  • 18
  • 6
  • 4
Oligo-Type
  • 3
Resistance Gene
  • 31
  • 30
  • 18
  • 7
  • 2
Expression Type
  • 82
  • 43
  • 1
Selectable Marker
  • 24
  • 20
  • 1
Promoter
  • 28
  • 24
  • 13
  • 10
  • 6
Format
  • 31
  • 27
  • 18
  • 13
89 Products

Type:
ORF
Application:
Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
411 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5760959
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
NCBI Accession:
NM_194326,NP_919307
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
411 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5467557
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Gene ID:
91582 (Human, RPS19BP1)
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3828572
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Gene ID:
91582 (Human, RPS19BP1)
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3828577
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Gene ID:
509108 (Cow, RPS19BP1)
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856230
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Gene ID:
66538 (Mouse, RPS19BP1)
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096828
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Gene ID:
91582 (Human, RPS19BP1)
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
411 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320139
$195.89
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
411 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4710262
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
411 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4839393
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
411 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4772301
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
411 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4624104
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
411 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4480633
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
411 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4415547
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Gene ID:
91582 (Human, RPS19BP1)
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3412043
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Gene ID:
91582 (Human, RPS19BP1)
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3418201
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
Gene ID:
91582 (Human, RPS19BP1)
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3417916
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
NCBI Accession:
NM_194326,NP_919307
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3386505
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
NCBI Accession:
NM_194326
Species:
Human
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of RPS19BP1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5158315
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
NCBI Accession:
NM_001130578
Species:
Rat
Synonyms:
RPS19BP1, Rps19bp1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Rps19bp1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5158317
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
Ribosomal Protein S19 Binding Protein 1 (RPS19BP1)
NCBI Accession:
NM_001130578,NP_001124050
Species:
Rat
Synonyms:
RPS19BP1, Rps19bp1
Insert length:
288 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3368586
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to RPS19BP1

  • ribosomal protein S19 binding protein 1 (RPS19BP1)
  • ribosomal protein S19 binding protein 1 (Rps19bp1)
  • 2510038A11Rik
  • AI604923
  • AROS
  • dJ1104E15.4
  • S19BP

Gene-IDs for different species

GENE IDSPECIES
91582 Homo sapiens
66538 Mus musculus
509108 Bos taurus
418011 Gallus gallus

Protein level used designations for RPS19BP1

  • 40S ribosomal protein S19-binding protein 1
  • RPS19-binding protein 1
  • active regulator of SIRT1
  • homolog of mouse S19 binding protein
  • S19 binding protein
Other products related to RPS19BP1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com