SAA1 (Serum Amyloid A1, SAA1)

Short Description: This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Jun 2012].
More information related to gene SAA1.
Products related to SAA1 Gene:
112 Products
Type
  • 109
  • 3
Species
  • 73
  • 39
Application
  • 70
  • 21
  • 16
  • 12
  • 1
Fusion tag
  • 36
  • 15
  • 11
  • 10
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 4
  • 4
Vector
  • 48
  • 29
  • 10
  • 9
  • 6
Insert
  • 50
  • 33
  • 14
  • 6
  • 4
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 52
  • 31
  • 22
  • 4
  • 2
Expression Type
  • 73
  • 40
  • 22
Selectable Marker
  • 22
  • 22
  • 18
  • 1
Promoter
  • 31
  • 30
  • 22
  • 13
  • 6
Format
  • 58
  • 22
  • 17
  • 15

Type:
ORF
Application:
Protein Expression
Gene:
Serum Amyloid A1 (SAA1)
NCBI Accession:
NM_199161,NP_954630
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5338206
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Serum Amyloid A1 (SAA1)
NCBI Accession:
NM_000331,NP_000322
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5338207
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Gene ID:
6288 (Human, SAA1)
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4035497
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Gene ID:
6288 (Human, SAA1)
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4035496
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Gene ID:
20208 (Mouse (Murine), SAA1)
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036694
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
NCBI Accession:
NM_000331
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3580093
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
NCBI Accession:
NM_009117
Species:
Mouse (Murine)
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564708
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Serum Amyloid A1
Species:
Human
Synonyms:
PIG4, SAA, SAA2, TP53I4, zgc:103580, SAA1, Saa-1, Saa2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189510
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720871
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
NCBI Accession:
NM_009117
Species:
Mouse (Murine)
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720872
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Gene ID:
6288 (Human, SAA1)
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4035499
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Gene ID:
6288 (Human, SAA1)
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4035498
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Gene ID:
20208 (Mouse (Murine), SAA1)
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036693
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Gene ID:
6288 (Human, SAA1)
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312970
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Serum Amyloid A1 (SAA1)
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
537 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3392022
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Serum Amyloid A1 (SAA1)
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4480766
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Serum Amyloid A1 (SAA1)
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4415680
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4624237
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4772434
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Serum Amyloid A1 (SAA1)
Species:
Human
Synonyms:
SAA1, saa, LOC694827, Sden_2438, Mmc1_0571, Riean_0971, Saa1, LOC100009168, LOC101120204
Insert length:
369 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4710444
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to SAA1

  • serum amyloid A1 (SAA1)
  • serum amyloid A (saa)
  • amyloid protein A (LOC694827)
  • serum amyloid A protein (Sden_2438)
  • serum amyloid A protein (Mmc1_0571)
  • serum amyloid a protein (Riean_0971)
  • serum amyloid A 1 (Saa1)
  • serum amyloid protein A (LOC100009168)
  • serum amyloid A protein (LOC101120204)
  • PIG4
  • SAA
  • Saa-1
  • SAA1
  • SAA2
  • Saa2
  • TP53I4
  • zgc:103580

Gene-IDs for different species

GENE IDSPECIES
6288 Homo sapiens
403585 Canis lupus familiaris
449557 Danio rerio
480749 Canis lupus familiaris
678660 Felis catus
694827 Macaca mulatta
100034017 Equus caballus
751814 Canis lupus familiaris
4018937 Shewanella denitrificans OS217
4481493 Magnetococcus marinus MC-1
10001727 Riemerella anatipestifer ATCC 11845 = DSM 15868
20208 Mus musculus
616035 Bos taurus
100009168 Oryctolagus cuniculus
101120204 Ovis aries musimon

Protein level used designations for SAA1

  • serum amyloid A protein
  • serum amyloid A-1 protein
  • tumor protein p53 inducible protein 4
  • saa1
  • serum amyloid A1
  • serum amyloid A
  • serum amyloid a protein
  • serum amyloid A 2
Other products related to SAA1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com