SIGLEC8 (Sialic Acid Binding Ig-Like Lectin 8, SIGLEC8)

Short Description: Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM\\\\; MIM 603492) that mediates an association with SLAM-associated protein (SAP\\\\; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010].
More information related to gene SIGLEC8.
Products related to SIGLEC8 Gene:
34 Products
Type
  • 33
  • 1
Species
  • 34
Application
  • 17
  • 8
  • 7
  • 6
Fusion tag
  • 10
  • 6
  • 4
  • 4
  • 3
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 2
Vector
  • 13
  • 11
  • 4
  • 3
  • 2
Insert
  • 12
  • 7
  • 7
  • 3
  • 2
Oligo-Type
  • 1
Resistance Gene
  • 13
  • 12
  • 8
  • 2
Expression Type
  • 31
  • 19
Selectable Marker
  • 10
  • 10
Promoter
  • 12
  • 12
  • 5
  • 4
  • 3
Format
  • 14
  • 8
  • 8
  • 4

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Gene ID:
27181 (Human, SIGLEC8)
Synonyms:
SIGLEC8, LOC506364
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090365
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Gene ID:
27181 (Human, SIGLEC8)
Synonyms:
SIGLEC8, LOC506364
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090366
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3392195
$300.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Application:
RNA Interference
Gene:
Sialic Acid Binding Ig-Like Lectin 8
Species:
Human
Synonyms:
SAF2, SIGLEC-8, SIGLEC8L, SIGLEC8
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • SIGLEC8 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3285060
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
NCBI Accession:
NM_014442
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SIGLEC8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5122240
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Gene ID:
27181 (Human, SIGLEC8)
Synonyms:
SIGLEC8, LOC506364
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5053225

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5034280
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
NCBI Accession:
NM_014442
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4490299
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4512178
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
NCBI Accession:
NM_014442
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Insert length:
1500 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4633768
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
NCBI Accession:
NM_014442
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Insert length:
1500 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4781989
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
NCBI Accession:
NM_014442
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4425209
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4573385
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
NCBI Accession:
NM_014442
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Insert length:
1500 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4710938
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
NCBI Accession:
NM_014442
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Insert length:
1500 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4840069
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
NCBI Accession:
NM_014442
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SIGLEC8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5237619
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
NCBI Accession:
NM_014442,NP_055257
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5407699
$590.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5407698
$650.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Gene ID:
27181 (Human, SIGLEC8)
Synonyms:
SIGLEC8, LOC506364
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3797881

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN3797880
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948188

Components:
  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3713973
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Vector type:
Retroviral Vector
Vector backbone:
pRS
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948189

Components:
  • Gene-specific shRNA expression pRS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3651409
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to SIGLEC8

  • sialic acid binding Ig like lectin 8 (SIGLEC8)
  • sialic acid-binding Ig-like lectin 8 (LOC506364)
  • SAF2
  • SIGLEC-8
  • SIGLEC8
  • SIGLEC8L

Gene-IDs for different species

GENE IDSPECIES
27181 Homo sapiens
456249 Pan troglodytes
506364 Bos taurus
100595640 Nomascus leucogenys

Protein level used designations for SIGLEC8

  • CDw329
  • SAF-2
  • sialic acid-binding Ig-like lectin 8
  • sialoadhesin family member 2
  • sialic acid binding Ig-like lectin 8
Other products related to SIGLEC8 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com