SLC15A1 (Solute Carrier Family 15 (Oligopeptide Transporter), Member 1, SLC15A1)

Short Description: This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010].
More information related to gene SLC15A1.
Products related to SLC15A1 Gene:
  • 109
  • 3
  • 40
  • 39
  • 30
  • 2
  • 1
  • 58
  • 34
  • 19
  • 16
Fusion tag
  • 41
  • 15
  • 13
  • 12
  • 6
Vector Backbone
  • 10
  • 8
  • 8
  • 6
  • 6
  • 38
  • 30
  • 16
  • 14
  • 9
  • 49
  • 28
  • 16
  • 8
  • 6
  • 3
Resistance Gene
  • 51
  • 30
  • 22
  • 6
  • 2
Expression Type
  • 97
  • 49
Selectable Marker
  • 27
  • 24
  • 10
  • 1
  • 37
  • 28
  • 17
  • 9
  • 8
  • 36
  • 35
  • 23
  • 18
112 Products

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
56643 (Mouse (Murine), SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3802379
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
56643 (Mouse (Murine), SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3802380
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3986465
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3986466
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3986467
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
521181 (Cow (Bovine), SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4063409
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
56643 (Mouse (Murine), SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3802381
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
56643 (Mouse (Murine), SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3802382
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3986462
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3986463
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3986464
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
521181 (Cow (Bovine), SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4063408
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Insert length:
2127 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5325521
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3413731
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
NCBI Accession:
Rat (Rattus)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Insert length:
453 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3370302
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
NCBI Accession:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SLC15A1
Viral Particles
-80 °C
Catalog No. ABIN5107965
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
NCBI Accession:
Mouse (Murine)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Slc15a1
Viral Particles
-80 °C
Catalog No. ABIN5107967
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
NCBI Accession:
Rat (Rattus)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Slc15a1
Viral Particles
-80 °C
Catalog No. ABIN5107969
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Protein Expression
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
NCBI Accession:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Insert length:
2127 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5382903
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
NCBI Accession:
Rat (Rattus)
SLC15A1, slc15a1, Slc15a1, slc15a1b
Insert length:
453 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5382905
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to SLC15A1

  • solute carrier family 15 member 1 (SLC15A1)
  • solute carrier family 15 (oligopeptide transporter), member 1 (slc15a1)
  • solute carrier family 15 member 1 (slc15a1)
  • solute carrier family 15 (oligopeptide transporter), member 1 (Slc15a1)
  • solute carrier family 15 member 1 (Slc15a1)
  • solute carrier family 15 (oligopeptide transporter), member 1b (slc15a1b)
  • D630032F02
  • fd47f07
  • HPECT1
  • HPEPT1
  • pect1
  • PECT1
  • PEPT-1
  • pept1
  • PEPT1
  • Pept1
  • SLC15A1
  • slc15a1
  • wu:fd47f07

Gene-IDs for different species

397624 Sus scrofa
467307 Pan troglodytes
574257 Macaca mulatta
100145353 Xenopus (Silurana) tropicalis
100450526 Pongo abelii
100565958 Anolis carolinensis
100582457 Nomascus leucogenys
100219866 Taeniopygia guttata
6564 Homo sapiens
56643 Mus musculus
378789 Gallus gallus
521181 Bos taurus
117261 Rattus norvegicus
403561 Canis lupus familiaris
100009186 Oryctolagus cuniculus
793301 Danio rerio

Protein level used designations for SLC15A1

  • peptide transporter 1
  • solute carrier family 15 member 1
  • solute carrier family 15 (oligopeptide transporter), member 1
  • proton-dependent dipeptide transporter PEPT1
  • solute carrier family 15 member 1-like
  • Caco-2 oligopeptide transporter
  • intestinal H+/peptide cotransporter
  • macrophage oligopeptide transporter PEPT1
  • oligopeptide transporter, small intestine isoform
  • intestinal H(+)/peptide cotransporter
  • intestinal peptide transporter PEPT1
  • proton-coupled dipeptide cotransporter
  • peptide transporter PepT1
  • proton-dependent gastrointestinal peptide transporter 1
  • pineal gland-specific PEPT1
  • proton-coupled peptide cotransporter PepT1
Other products related to SLC15A1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website