SLC15A1 (Solute Carrier Family 15 (Oligopeptide Transporter), Member 1, SLC15A1)

Short Description: This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010].
More information related to gene SLC15A1.
Products related to SLC15A1 Gene:
116 Products
Type
  • 112
  • 4
Species
  • 42
  • 40
  • 31
  • 2
  • 1
Application
  • 58
  • 34
  • 23
  • 16
Fusion tag
  • 42
  • 18
  • 13
  • 12
  • 6
Vector Backbone
  • 10
  • 8
  • 8
  • 6
  • 6
Vector
  • 38
  • 33
  • 16
  • 14
  • 9
Insert
  • 49
  • 28
  • 19
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 54
  • 30
  • 22
  • 6
  • 2
Expression Type
  • 100
  • 52
Selectable Marker
  • 30
  • 24
  • 10
  • 1
Promoter
  • 40
  • 31
  • 17
  • 9
  • 8
Format
  • 39
  • 36
  • 23
  • 18

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
56643 (Mouse (Murine), SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3802379
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
56643 (Mouse (Murine), SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3802380
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
521181 (Cow (Bovine), SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063409
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986466
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986467
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986465
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
56643 (Mouse (Murine), SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3802381
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
56643 (Mouse (Murine), SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3802382
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
521181 (Cow (Bovine), SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063408
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986463
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986462
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986464
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Insert length:
2127 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325521
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
Gene ID:
6564 (Human, SLC15A1)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413731
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
NCBI Accession:
NM_001079838,NP_001073307
Species:
Rat (Rattus)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Insert length:
453 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3370302
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
NCBI Accession:
NM_001079838,NP_001073307
Species:
Rat (Rattus)
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Insert length:
453 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5382905
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1
Species:
Human
Synonyms:
SLC15A1, pect1, pept1, HPECT1, HPEPT1, PEPT1, D630032F02, PECT1, PEPT-1, Pept1, fd47f07, slc15a1, wu:fd47f07
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • SLC15A1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3344216
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1
Species:
Rat (Rattus)
Synonyms:
SLC15A1, pect1, pept1, HPECT1, HPEPT1, PEPT1, D630032F02, PECT1, PEPT-1, Pept1, fd47f07, slc15a1, wu:fd47f07
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Slc15a1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3350651
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1
Species:
Mouse (Murine)
Synonyms:
SLC15A1, pect1, pept1, HPECT1, HPEPT1, PEPT1, D630032F02, PECT1, PEPT-1, Pept1, fd47f07, slc15a1, wu:fd47f07
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Slc15a1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3263462
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Solute Carrier Family 15 (Oligopeptide Transporter), Member 1 (SLC15A1)
NCBI Accession:
NM_005073
Species:
Human
Synonyms:
SLC15A1, slc15a1, Slc15a1, slc15a1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SLC15A1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5107965
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to SLC15A1

  • solute carrier family 15 member 1 (SLC15A1)
  • solute carrier family 15 (oligopeptide transporter), member 1 (slc15a1)
  • solute carrier family 15 member 1 (slc15a1)
  • solute carrier family 15 (oligopeptide transporter), member 1 (Slc15a1)
  • solute carrier family 15 member 1 (Slc15a1)
  • solute carrier family 15 (oligopeptide transporter), member 1b (slc15a1b)
  • D630032F02
  • fd47f07
  • HPECT1
  • HPEPT1
  • pect1
  • PECT1
  • PEPT-1
  • pept1
  • PEPT1
  • Pept1
  • SLC15A1
  • slc15a1
  • wu:fd47f07

Gene-IDs for different species

GENE IDSPECIES
397624 Sus scrofa
467307 Pan troglodytes
574257 Macaca mulatta
100145353 Xenopus (Silurana) tropicalis
100450526 Pongo abelii
100565958 Anolis carolinensis
100582457 Nomascus leucogenys
100219866 Taeniopygia guttata
6564 Homo sapiens
56643 Mus musculus
378789 Gallus gallus
521181 Bos taurus
117261 Rattus norvegicus
403561 Canis lupus familiaris
100009186 Oryctolagus cuniculus
793301 Danio rerio

Protein level used designations for SLC15A1

  • peptide transporter 1
  • solute carrier family 15 member 1
  • solute carrier family 15 (oligopeptide transporter), member 1
  • proton-dependent dipeptide transporter PEPT1
  • solute carrier family 15 member 1-like
  • Caco-2 oligopeptide transporter
  • intestinal H+/peptide cotransporter
  • macrophage oligopeptide transporter PEPT1
  • oligopeptide transporter, small intestine isoform
  • intestinal H(+)/peptide cotransporter
  • intestinal peptide transporter PEPT1
  • proton-coupled dipeptide cotransporter
  • peptide transporter PepT1
  • proton-dependent gastrointestinal peptide transporter 1
  • pineal gland-specific PEPT1
  • proton-coupled peptide cotransporter PepT1
Other products related to SLC15A1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com