SOX18 (SRY (Sex Determining Region Y)-Box 18, SOX18)

Short Description: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. This protein plays a role in hair, blood vessel, and lymphatic vessel development. Mutations in this gene have been associated with recessive and dominant forms of hypotrichosis-lymphedema-telangiectasia. [provided by RefSeq, Jul 2008].
More information related to gene SOX18.
Products related to SOX18 Gene:
100 Products
Data Quality
  • 2
Type
  • 97
  • 3
Species
  • 36
  • 28
  • 28
  • 4
  • 2
Application
  • 56
  • 32
  • 23
  • 16
Fusion tag
  • 40
  • 15
  • 10
  • 9
  • 8
Vector Backbone
  • 9
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 35
  • 12
  • 9
  • 5
Insert
  • 43
  • 20
  • 18
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 44
  • 32
  • 18
  • 3
  • 2
Expression Type
  • 95
  • 47
  • 2
Selectable Marker
  • 26
  • 24
Promoter
  • 30
  • 29
  • 19
  • 12
  • 8
Format
  • 30
  • 27
  • 22
  • 21

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
398227 (Xenopus laevis, SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845622
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
54345 (Human, SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815444
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
54345 (Human, SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815445
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
54345 (Human, SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815446
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
398226 (Xenopus laevis, SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4019511
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
519439 (Cow (Bovine), SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063295
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
311723 (Rat (Rattus), SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053180
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
20672 (Mouse (Murine), SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217376
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
398227 (Xenopus laevis, SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845621
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
54345 (Human, SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815447
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
54345 (Human, SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815448
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
398226 (Xenopus laevis, SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4019510
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
519439 (Cow (Bovine), SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063294
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
311723 (Rat (Rattus), SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053181
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
Gene ID:
20672 (Mouse (Murine), SOX18)
Synonyms:
SOX18, Sox18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217374
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
NCBI Accession:
NM_018419,NP_060889
Species:
Human
Synonyms:
SOX18, Sox18
Insert length:
1750 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, SP6 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948185

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ikhapoh, Pelham, Agrawal: "Sry-type HMG box 18 contributes to the differentiation of bone marrow-derived mesenchymal stem cells to endothelial cells." in: Differentiation; research in biological diversity, Vol. 89, Issue 3-4, pp. 87-96, 2015 (Pubmed)
  • Gross, Aggarwal, Kumar, Tian, Kasa, Bogatcheva, Datar, Verin, Fineman, Black: "Sox18 preserves the pulmonary endothelial barrier under conditions of increased shear stress." in: Journal of cellular physiology, Vol. 229, Issue 11, pp. 1802-16, 2014 (Pubmed)
Catalog No. ABIN3393818
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
NCBI Accession:
NM_001024781,NP_001019952
Species:
Rat (Rattus)
Synonyms:
SOX18, Sox18
Insert length:
1134 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3371653
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
NCBI Accession:
NM_018419,NP_060889
Species:
Human
Synonyms:
SOX18, Sox18
Insert length:
1155 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5458396
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
NCBI Accession:
NM_001024781,NP_001019952
Species:
Rat (Rattus)
Synonyms:
SOX18, Sox18
Insert length:
1134 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5458397
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Application:
RNA Interference
Gene:
SRY (Sex Determining Region Y)-Box 18
Species:
Mouse (Murine)
Synonyms:
HLTS, AI385749, Ra, Ragl
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Sox18 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3268816
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to SOX18

  • SRY-box 18 (SOX18)
  • SRY box 18 (Sox18)
  • SRY (sex determining region Y)-box 18 (Sox18)
  • AI385749
  • HLTS
  • Ra
  • Ragl

Gene-IDs for different species

GENE IDSPECIES
54345 Homo sapiens
100049667 Sus scrofa
519439 Bos taurus
311723 Rattus norvegicus
20672 Mus musculus

Protein level used designations for SOX18

  • SRY-box 18
  • transcription factor SOX-18
  • SRY-box containing gene 18
  • Sry-related HMG-box gene 18
  • ragged
Other products related to SOX18 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com