SOX3 (SRY (Sex Determining Region Y)-Box 3, SOX3)

Short Description: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. Mutations in this gene have been associated with X-linked mental retardation with growth hormone deficiency. [provided by RefSeq, Jul 2008].
More information related to gene SOX3.
Products related to SOX3 Gene:
65 Products
Type
  • 63
  • 2
Species
  • 35
  • 22
  • 4
  • 2
  • 2
Application
  • 32
  • 22
  • 15
  • 12
Fusion tag
  • 28
  • 8
  • 6
  • 6
  • 5
Vector Backbone
  • 4
  • 4
  • 4
  • 4
  • 2
Vector
  • 23
  • 20
  • 8
  • 6
  • 6
Insert
  • 30
  • 13
  • 8
  • 6
  • 4
Oligo-Type
  • 2
Resistance Gene
  • 32
  • 21
  • 8
  • 2
  • 2
Expression Type
  • 59
  • 32
Selectable Marker
  • 19
  • 18
Promoter
  • 21
  • 15
  • 10
  • 9
  • 6
Format
  • 19
  • 18
  • 15
  • 13

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
30529 (Zebrafish (Danio rerio), SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046432
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
30529 (Zebrafish (Danio rerio), SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071530
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
399335 (Xenopus laevis, SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846742
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
493228 (Xenopus tropicalis, SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885701
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
6658 (Human, SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000415
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
6658 (Human, SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000416
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
30529 (Zebrafish (Danio rerio), SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046433
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
30529 (Zebrafish (Danio rerio), SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071529
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Species:
Human
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Insert length:
1341 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5744024
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
399335 (Xenopus laevis, SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846743
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
493228 (Xenopus tropicalis, SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885700
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
6658 (Human, SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000413
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Gene ID:
6658 (Human, SOX3)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000414
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Species:
Human
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Insert length:
1341 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4711594
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
Species:
Human
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Insert length:
1341 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4840725
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
NCBI Accession:
NM_005634,NP_005625
Species:
Human
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Insert length:
1341 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5413042
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
SRY (Sex Determining Region Y)-Box 3
Species:
Human
Synonyms:
GHDX, MRGH, PHP, PHPX, SOXB, CH3, Sry, Xlsox3, Xtsox3, mrgh, soxb, xSox3, Sox-3, fc93f07, id:ibd2036, sb:cb493, wu:fc93f07, wu:fd02a08, zgc:110279, sox3-a, xSox-B1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • SOX3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3344301
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
SRY (Sex Determining Region Y)-Box 3
Species:
Mouse (Murine)
Synonyms:
GHDX, MRGH, PHP, PHPX, SOXB, CH3, Sry, Xlsox3, Xtsox3, mrgh, soxb, xSox3, Sox-3, fc93f07, id:ibd2036, sb:cb493, wu:fc93f07, wu:fd02a08, zgc:110279, sox3-a, xSox-B1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Sox3 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3270785
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
NCBI Accession:
NM_009237
Species:
Mouse (Murine)
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Sox3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5125440
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 3 (SOX3)
NCBI Accession:
NM_005634
Species:
Human
Synonyms:
SOX3, Tsp_06143, sox3, Sox3, sox3.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SOX3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5125438
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to SOX3

  • SRY-box 3 (SOX3)
  • transcription factor SOX-3 (Tsp_06143)
  • SRY-box 3 (sox3)
  • SRY (sex determining region Y)-box 3 (Sox3)
  • SRY (sex determining region Y)-box 3 (sox3)
  • SRY-box 3 S homeolog (sox3.S)
  • SRY-box 3 (Sox3)
  • CH3
  • fc93f07
  • GHDX
  • id:ibd2036
  • mrgh
  • MRGH
  • PHP
  • PHPX
  • sb:cb493
  • Sox-3
  • sox3-a
  • soxb
  • SOXB
  • Sry
  • wu:fc93f07
  • wu:fd02a08
  • Xlsox3
  • xSox-B1
  • xSox3
  • Xtsox3
  • zgc:110279

Gene-IDs for different species

GENE IDSPECIES
6658 Homo sapiens
374019 Gallus gallus
10911545 Trichinella spiralis
493228 Xenopus (Silurana) tropicalis
100349101 Oryctolagus cuniculus
20675 Mus musculus
30529 Danio rerio
399335 Xenopus laevis
492178 Canis lupus familiaris
781679 Bos taurus
100623770 Sus scrofa
679158 Rattus norvegicus

Protein level used designations for SOX3

  • transcription factor SOX-3
  • SRY-related protein CH3
  • cSox3
  • transcription factor SOX3
  • transcription factor Sox-3
  • SRY (sex determining region Y)-box 3
  • 2036
  • transcription factor Sox-3-A
  • xSox3
  • LOW QUALITY PROTEIN: transcription factor SOX-3
  • SRY-box containing gene 3
Other products related to SOX3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com