SSTR1 (Somatostatin Receptor 1, SSTR1)

Short Description: Receptor for somatostatin with higher affinity for somatostatin-14 than -28. This receptor is coupled via pertussis toxin sensitive G proteins to inhibition of adenylyl cyclase. In addition it stimulates phosphotyrosine phosphatase and Na(+)/H(+) exchanger via pertussis toxin insensitive G proteins.
More information related to gene SSTR1.
Products related to SSTR1 Gene:
94 Products
Type
  • 92
  • 2
Species
  • 40
  • 28
  • 26
Application
  • 51
  • 23
  • 18
  • 16
Fusion tag
  • 31
  • 16
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 27
  • 12
  • 9
  • 5
Insert
  • 30
  • 25
  • 21
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 36
  • 32
  • 18
  • 6
  • 2
Expression Type
  • 87
  • 50
Selectable Marker
  • 26
  • 25
  • 1
Promoter
  • 31
  • 31
  • 14
  • 9
  • 8
Format
  • 34
  • 27
  • 22
  • 11

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Somatostatin Receptor 1 (SSTR1)
Gene ID:
6751 (Human, SSTR1)
Synonyms:
SSTR1, LOC100313735, Sstr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805496
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Somatostatin Receptor 1 (SSTR1)
Species:
Human
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5733867
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Somatostatin Receptor 1 (SSTR1)
Gene ID:
6751 (Human, SSTR1)
Synonyms:
SSTR1, LOC100313735, Sstr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805497
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Somatostatin Receptor 1 (SSTR1)
Gene ID:
6751 (Human, SSTR1)
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316917
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
Species:
Human
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
4700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3392472
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
Species:
Human
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4481645
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
Species:
Human
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4416559
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 1 (SSTR1)
Species:
Human
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4625116
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 1 (SSTR1)
Species:
Human
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4773337
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 1 (SSTR1)
Species:
Human
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4711837
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 1 (SSTR1)
Species:
Human
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4840968
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
Gene ID:
6751 (Human, SSTR1)
Synonyms:
SSTR1, LOC100313735, Sstr1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3421165
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
Gene ID:
20605 (Mouse (Murine), SSTR1)
Synonyms:
SSTR1, LOC100313735, Sstr1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3405916
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
Gene ID:
6751 (Human, SSTR1)
Synonyms:
SSTR1, LOC100313735, Sstr1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3397211
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
Gene ID:
6751 (Human, SSTR1)
Synonyms:
SSTR1, LOC100313735, Sstr1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3424479
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
NCBI Accession:
NM_012719,NP_036851
Species:
Rat (Rattus)
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3372237
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
NCBI Accession:
NM_009216,NP_033242
Species:
Mouse (Murine)
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3372236
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
NCBI Accession:
NM_001049,NP_001040
Species:
Human
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5379685
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Somatostatin Receptor 1 (SSTR1)
NCBI Accession:
NM_012719,NP_036851
Species:
Rat (Rattus)
Synonyms:
SSTR1, LOC100313735, Sstr1
Insert length:
1176 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5379686
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Application:
RNA Interference
Gene:
Somatostatin Receptor 1
Species:
Mouse (Murine)
Synonyms:
SSTR1, LOC100313735, SRIF-2, SS-1-R, SS1-R, SS1R, Smstr-1, Smstr1, sst1, Gpcrrna
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Sstr1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3269205
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to SSTR1

  • somatostatin receptor 1 (SSTR1)
  • somatostatin receptor 1 (LOC100313735)
  • somatostatin receptor 1 (Sstr1)
  • uncharacterized SSTR1 (SSTR1)
  • Gpcrrna
  • LOC100313735
  • Smstr-1
  • Smstr1
  • SRIF-2
  • SS-1-R
  • SS1-R
  • SS1R
  • sst1
  • SSTR1

Gene-IDs for different species

GENE IDSPECIES
100060276 Equus caballus
467434 Pan troglodytes
100313735 Saccoglossus kowalevskii
6751 Homo sapiens
20605 Mus musculus
25033 Rattus norvegicus
403455 Canis lupus familiaris
397004 Sus scrofa
540013 Bos taurus
100731850 Cavia porcellus
771648 Gallus gallus
100359158 Oryctolagus cuniculus

Protein level used designations for SSTR1

  • somatostatin receptor type 1
  • somatostatin receptor 1
  • RNGPCRRNA
  • SRIF-2
  • SS-1-R
  • SS1-R
  • SS1R
  • Somatostatin receptor subtype 1
Other products related to SSTR1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com