STAT2 (Signal Transducer and Activator of Transcription 2, 113kDa, STAT2)

Short Description: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010].
More information related to gene STAT2.
Products related to STAT2 Gene:
130 Products
Type
  • 125
  • 5
Species
  • 58
  • 43
  • 27
  • 2
Application
  • 82
  • 24
  • 22
  • 16
  • 2
Fusion tag
  • 40
  • 16
  • 13
  • 12
  • 8
Vector Backbone
  • 7
  • 7
  • 6
  • 6
  • 6
Vector
  • 56
  • 38
  • 12
  • 9
  • 6
Insert
  • 54
  • 36
  • 19
  • 8
  • 6
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 57
  • 40
  • 22
  • 6
  • 2
Expression Type
  • 92
  • 50
  • 26
Selectable Marker
  • 26
  • 26
  • 25
  • 1
Promoter
  • 37
  • 34
  • 29
  • 14
  • 8
Format
  • 68
  • 27
  • 22
  • 13

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Gene ID:
100170174 (Xenopus tropicalis, STAT2)
Synonyms:
stat2, STAT2, Stat2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874442
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Gene ID:
6773 (Human, STAT2)
Synonyms:
stat2, STAT2, Stat2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086998
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Gene ID:
288774 (Rat (Rattus), STAT2)
Synonyms:
stat2, STAT2, Stat2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049704
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
NCBI Accession:
NM_005419
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3594109
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
NCBI Accession:
NM_001011905
Species:
Rat (Rattus)
Synonyms:
stat2, STAT2, Stat2
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3594110
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa
Species:
Human
Synonyms:
wu:fj84d07, p113, stat2, 1600010G07Rik, AW496480, ISGF-3, P113, STAT113
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188898
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa
Species:
Rat (Rattus)
Synonyms:
wu:fj84d07, p113, stat2, 1600010G07Rik, AW496480, ISGF-3, P113, STAT113
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196724
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Insert length:
2556 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5729427
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Gene ID:
100170174 (Xenopus tropicalis, STAT2)
Synonyms:
stat2, STAT2, Stat2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874443
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Gene ID:
6773 (Human, STAT2)
Synonyms:
stat2, STAT2, Stat2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086997
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Gene ID:
288774 (Rat (Rattus), STAT2)
Synonyms:
stat2, STAT2, Stat2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049703
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Gene ID:
6773 (Human, STAT2)
Synonyms:
stat2, STAT2, Stat2
Insert length:
2556 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5321784
$214.67
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
NCBI Accession:
NM_005419,NP_005410
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Insert length:
3200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3380196
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Insert length:
2556 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4481699
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Insert length:
2556 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4416613
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Insert length:
2556 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4513164
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Insert length:
2556 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4625170
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Insert length:
2556 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4773391
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Insert length:
2556 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4574371
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 2, 113kDa (STAT2)
Species:
Human
Synonyms:
stat2, STAT2, Stat2
Insert length:
2556 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4711921
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to STAT2

  • signal transducer and activator of transcription 2 (stat2)
  • signal transducer and activator of transcription 2 (STAT2)
  • AGAP000099-PA (STAT2)
  • signal transducer and activator of transcription 2 (Stat2)
  • 1600010G07Rik
  • AW496480
  • ISGF-3
  • p113
  • P113
  • stat2
  • STAT113
  • wu:fj84d07

Gene-IDs for different species

GENE IDSPECIES
565200 Danio rerio
712694 Macaca mulatta
1272172 Anopheles gambiae str. PEST
100270812 Salmo salar
20847 Mus musculus
288774 Rattus norvegicus
100344467 Oryctolagus cuniculus
100858732 Gallus gallus
6773 Homo sapiens
481111 Canis lupus familiaris
100719719 Cavia porcellus
396923 Sus scrofa
451996 Pan troglodytes
511023 Bos taurus
101108211 Ovis aries

Protein level used designations for STAT2

  • fj84d07
  • signal transducer and activator of transcription 2
  • signal transducer and activator of transcription (AGAP000099-PA)
  • interferon alpha induced transcriptional activator
Other products related to STAT2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com