TCEAL3 (Transcription Elongation Factor A (SII)-Like 3, TCEAL3)

Short Description: This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family contain TFA domains and may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. Multiple family members are located on the X chromosome. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008].
More information related to gene TCEAL3.
Products related to TCEAL3 Gene:
105 Products
Type
  • 102
  • 3
Species
  • 61
  • 44
Application
  • 67
  • 19
  • 16
  • 12
  • 1
Fusion tag
  • 31
  • 14
  • 10
  • 10
  • 6
Vector Backbone
  • 6
  • 6
  • 4
  • 4
  • 4
Vector
  • 48
  • 29
  • 8
  • 7
  • 6
Insert
  • 49
  • 27
  • 14
  • 6
  • 4
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 48
  • 30
  • 20
  • 4
  • 2
Expression Type
  • 67
  • 37
  • 26
Selectable Marker
  • 26
  • 19
  • 18
  • 1
Promoter
  • 34
  • 27
  • 22
  • 9
  • 6
Format
  • 58
  • 18
  • 17
  • 12

Type:
ORF
Application:
Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
Species:
Human
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Insert length:
603 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5753092
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001006933,NP_001006934
Species:
Human
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Insert length:
603 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5442679
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
Gene ID:
85012 (Human, TCEAL3)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094045
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
Gene ID:
85012 (Human, TCEAL3)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094046
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
Gene ID:
594844 (Mouse (Murine), TCEAL3)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3865432
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001029978
Species:
Mouse (Murine)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3597769
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001006933
Species:
Human
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3565656
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Transcription Elongation Factor A (SII)-Like 3
Species:
Mouse (Murine)
Synonyms:
RGD1562504, 1100001D19Rik, TCEAL3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195524
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
Gene ID:
85012 (Human, TCEAL3)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094044
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
Gene ID:
85012 (Human, TCEAL3)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094047
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
Gene ID:
594844 (Mouse (Murine), TCEAL3)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3865431
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
Gene ID:
85012 (Human, TCEAL3)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Insert length:
603 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5319489
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_032926
Gene ID:
85012 (Human, TCEAL3)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Insert length:
603 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4917872
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001029978
Species:
Mouse (Murine)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3597748
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001029978
Species:
Mouse (Murine)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3597744
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001006933
Species:
Human
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3597761
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001029978
Species:
Mouse (Murine)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3597762
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001006933
Species:
Human
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3597767
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001029978
Species:
Mouse (Murine)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3597760
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Transcription Elongation Factor A (SII)-Like 3 (TCEAL3)
NCBI Accession:
NM_001029978
Species:
Mouse (Murine)
Synonyms:
TCEAL3, Tceal3, LOC101902451, LOC100053876, LOC103351958
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3597768
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to TCEAL3

  • transcription elongation factor A like 3 (TCEAL3)
  • transcription elongation factor A like 3 (Tceal3)
  • transcription elongation factor A (SII)-like 3 (Tceal3)
  • transcription elongation factor A protein-like 3 (LOC101902451)
  • transcription elongation factor A protein-like 3 (LOC100053876)
  • transcription elongation factor A protein-like 3 (LOC103351958)
  • 1100001D19Rik
  • RGD1562504
  • TCEAL3

Gene-IDs for different species

GENE IDSPECIES
85012 Homo sapiens
501628 Rattus norvegicus
594844 Mus musculus
101902451 Bos taurus
100053876 Equus caballus
100524295 Sus scrofa
103351958 Oryctolagus cuniculus

Protein level used designations for TCEAL3

  • TCEA-like protein 3
  • transcription elongation factor A protein-like 3
  • transcription elongation factor S-II protein-like 3
  • LOW QUALITY PROTEIN: transcription elongation factor A protein-like 3
  • transcription elongation factor A (SII)-like 3
Other products related to TCEAL3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com