TEK (TEK Tyrosine Kinase, Endothelial, TEK)

Short Description: The TEK receptor tyrosine kinase is expressed almost exclusively in endothelial cells in mice, rats, and humans. This receptor possesses a unique extracellular domain containing 2 immunoglobulin-like loops separated by 3 epidermal growth factor-like repeats that are connected to 3 fibronectin type III-like repeats. The ligand for the receptor is angiopoietin-1. Defects in TEK are associated with inherited venous malformations\; the TEK signaling pathway appears to be critical for endothelial cell-smooth muscle cell communication in venous morphogenesis. TEK is closely related to the TIE receptor tyrosine kinase. [provided by RefSeq, Jul 2008].
More information related to gene TEK.
Products related to TEK Gene:
145 Products
Data Quality
  • 1
Type
  • 140
  • 5
Species
  • 55
  • 48
  • 38
  • 2
  • 2
Application
  • 97
  • 26
  • 21
  • 16
  • 3
Fusion tag
  • 49
  • 16
  • 15
  • 14
  • 9
Vector Backbone
  • 11
  • 8
  • 8
  • 6
  • 6
Vector
  • 70
  • 39
  • 12
  • 9
  • 5
Insert
  • 61
  • 44
  • 19
  • 8
  • 6
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 70
  • 45
  • 22
  • 3
  • 2
Expression Type
  • 101
  • 49
  • 32
Selectable Marker
  • 32
  • 32
  • 26
Promoter
  • 49
  • 37
  • 29
  • 14
  • 8
Format
  • 80
  • 27
  • 24
  • 14

Type:
ORF
Application:
Protein Expression
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
NCBI Accession:
NM_000459,NP_000450
Species:
Human
Synonyms:
TEK, LOC100408334, tek, Tek
Insert length:
3375 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5341159
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
NCBI Accession:
NM_000459
Gene ID:
7010 (Human, TEK)
Synonyms:
TEK, LOC100408334, tek, Tek
Insert length:
3375 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4944850
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 2 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Gene ID:
30747 (Zebrafish (Danio rerio), TEK)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005443
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Gene ID:
21687 (Mouse (Murine), TEK)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875573
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Gene ID:
7010 (Human, TEK)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805622
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Gene ID:
280939 (Cow (Bovine), TEK)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048849
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
NCBI Accession:
NM_000459
Species:
Human
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3565691
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
NCBI Accession:
NM_013690
Species:
Mouse (Murine)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3598387
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
NCBI Accession:
NM_001105737
Species:
Rat (Rattus)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3598388
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
TEK Tyrosine Kinase, Endothelial
Species:
Mouse (Murine)
Synonyms:
TEK, DKFZp469E064, AA517024, Cd202b, Hyk, Tie2, tie-2, CD202B, TIE-2, TIE2, VMCM, VMCM1, Tie-2, tie2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194601
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
TEK Tyrosine Kinase, Endothelial
Species:
Rat (Rattus)
Synonyms:
TEK, DKFZp469E064, AA517024, Cd202b, Hyk, Tie2, tie-2, CD202B, TIE-2, TIE2, VMCM, VMCM1, Tie-2, tie2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196226
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
TEK Tyrosine Kinase, Endothelial
Species:
Human
Synonyms:
TEK, DKFZp469E064, AA517024, Cd202b, Hyk, Tie2, tie-2, CD202B, TIE-2, TIE2, VMCM, VMCM1, Tie-2, tie2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189216
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Gene ID:
30747 (Zebrafish (Danio rerio), TEK)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005442
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Gene ID:
7010 (Human, TEK)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805620
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Gene ID:
21687 (Mouse (Murine), TEK)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3810976
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Gene ID:
280939 (Cow (Bovine), TEK)
Synonyms:
TEK, LOC100408334, tek, Tek
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048850
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Species:
Human
Synonyms:
TEK, LOC100408334, tek, Tek
Insert length:
3375 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4513667
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Species:
Human
Synonyms:
TEK, LOC100408334, tek, Tek
Insert length:
3375 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4574875
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Species:
Human
Synonyms:
TEK, LOC100408334, tek, Tek
Insert length:
3375 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4712423
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TEK Tyrosine Kinase, Endothelial (TEK)
Species:
Human
Synonyms:
TEK, LOC100408334, tek, Tek
Insert length:
3375 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4841554
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to TEK

  • TEK receptor tyrosine kinase (TEK)
  • angiopoietin-1 receptor (LOC100408334)
  • TEK receptor tyrosine kinase (tek)
  • TEK receptor tyrosine kinase (Tek)
  • TEK tyrosine kinase, endothelial (tek)
  • AA517024
  • Cd202b
  • CD202B
  • DKFZp469E064
  • Hyk
  • TEK
  • tie-2
  • TIE-2
  • Tie-2
  • Tie2
  • TIE2
  • tie2
  • VMCM
  • VMCM1

Gene-IDs for different species

GENE IDSPECIES
403714 Canis lupus familiaris
465028 Pan troglodytes
707455 Macaca mulatta
100174302 Pongo abelii
100356675 Oryctolagus cuniculus
100408334 Callithrix jacchus
100492432 Xenopus (Silurana) tropicalis
100606897 Nomascus leucogenys
21687 Mus musculus
7010 Homo sapiens
396729 Sus scrofa
89804 Rattus norvegicus
280939 Bos taurus
30747 Danio rerio

Protein level used designations for TEK

  • growth factor receptor Tie2/Tek
  • TEK tyrosine kinase, endothelial (venous malformations, multiple cutaneous and mucosal)
  • Angiopoietin-1 receptor
  • TEK tyrosine kinase, endothelial
  • angiopoietin-1 receptor-like
  • STK1
  • angiopoietin-1 receptor
  • endothelial tyrosine kinase
  • mTIE2
  • p140 TEK
  • tunica interna endothelial cell kinase
  • tyrosine kinase with Ig and EGF homology domains-2
  • tyrosine-protein kinase receptor TEK
  • tyrosine-protein kinase receptor TIE-2
  • hTIE2
  • soluble TIE2 variant 1
  • soluble TIE2 variant 2
  • protein-tyrosine kinase Tie2
  • endothelial-specific receptor tyrosine kinase
  • tyrosine kinases that contain immunoglobulin-like loops and epidermal growth factor-similar domains 2
  • endothelium-specific receptor tyrosine kinase 2
  • tyrosine-protein kinase receptor Tie-2
Other products related to TEK such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com