TIRAP (Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein, TIRAP)

Short Description: The innate immune system recognizes microbial pathogens through Toll-like receptors (TLRs), which identify pathogen-associated molecular patterns. Different TLRs recognize different pathogen-associated molecular patterns and all TLRs have a Toll-interleukin 1 receptor (TIR) domain, which is responsible for signal transduction. The protein encoded by this gene is a TIR adaptor protein involved in the TLR4 signaling pathway of the immune system. It activates NF-kappa-B, MAPK1, MAPK3 and JNK, which then results in cytokine secretion and the inflammatory response. Alternative splicing of this gene results in several transcript variants\; however, not all variants have been fully described. [provided by RefSeq, Jul 2008].
More information related to gene TIRAP.
Products related to TIRAP Gene:
116 Products
Type
  • 114
  • 2
Species
  • 69
  • 45
  • 2
Application
  • 70
  • 30
  • 16
  • 12
Fusion tag
  • 31
  • 19
  • 15
  • 15
  • 6
Vector Backbone
  • 11
  • 11
  • 6
  • 5
  • 5
Vector
  • 40
  • 39
  • 20
  • 6
  • 5
Insert
  • 50
  • 38
  • 14
  • 6
  • 4
Oligo-Type
  • 2
Resistance Gene
  • 52
  • 29
  • 26
  • 7
  • 2
Expression Type
  • 110
  • 50
Selectable Marker
  • 35
  • 18
  • 1
Promoter
  • 50
  • 22
  • 21
  • 13
  • 6
Format
  • 45
  • 39
  • 21
  • 11

Type:
ORF
Application:
Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
771 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5744072
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
NCBI Accession:
NM_001039661,NP_001034750
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
666 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5413158
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Gene ID:
446390 (Xenopus laevis, TIRAP)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884018
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Gene ID:
114609 (Human, TIRAP)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831271
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Gene ID:
446390 (Xenopus laevis, TIRAP)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884017
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Gene ID:
114609 (Human, TIRAP)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831270
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Gene ID:
114609 (Human, TIRAP)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
771 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314228
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
771 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4417042
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
771 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4841739
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
771 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4712608
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
771 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4625599
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
771 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4482128
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
771 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4773820
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Gene ID:
114609 (Human, TIRAP)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3411670
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Gene ID:
114609 (Human, TIRAP)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3422001
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
Gene ID:
114609 (Human, TIRAP)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3418827
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
NCBI Accession:
NM_148910,NP_683708
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
708 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5413159
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
NCBI Accession:
NM_001039661,NP_001034750
Species:
Human
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3317119
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
NCBI Accession:
NM_001177847,NP_001171318
Species:
Mouse (Murine)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
750 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3336374
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Toll-Interleukin 1 Receptor (TIR) Domain Containing Adaptor Protein (TIRAP)
NCBI Accession:
NM_001177846,NP_001171317
Species:
Mouse (Murine)
Synonyms:
tirap, TIRAP, tirap.L, Tirap
Insert length:
750 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3336376
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to TIRAP

  • toll-interleukin 1 receptor (TIR) domain containing adaptor protein (tirap)
  • TIR domain containing adaptor protein (TIRAP)
  • toll-interleukin 1 receptor (TIR) domain containing adaptor protein L homeolog (tirap.L)
  • TIR domain containing adaptor protein (Tirap)
  • toll-interleukin 1 receptor (TIR) domain-containing adaptor protein (Tirap)
  • AA407980
  • BACTS1
  • C130027E04Rik
  • mal
  • Mal
  • MyD88-2
  • Tlr4ap
  • wyatt
  • Wyatt

Gene-IDs for different species

GENE IDSPECIES
403148 Danio rerio
419715 Gallus gallus
446390 Xenopus laevis
451654 Pan troglodytes
714377 Macaca mulatta
733541 Xenopus (Silurana) tropicalis
114609 Homo sapiens
609544 Canis lupus familiaris
531079 Bos taurus
100732763 Cavia porcellus
117149 Mus musculus
680127 Rattus norvegicus

Protein level used designations for TIRAP

  • MyD88 adapter-like protein
  • Toll-interleukin 1 receptor domain-containing adaptor protein
  • toll/interleukin-1 receptor domain-containing adapter protein
  • TIR domain-containing adaptor protein
  • Toll-like receptor adaptor protein
  • adapter protein wyatt
  • adaptor protein Wyatt
  • toll-interleukin 1 receptor domain-containing adaptor protein
  • TIR domain-containing adapter protein
  • Toll-like receptor 4 adaptor protein
  • myD88 adapter-like protein
Other products related to TIRAP such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com