Ube2t (Ubiquitin-Conjugating Enzyme E2T (Putative), Ube2t)

Short Description: The covalent conjugation of ubiquitin to proteins regulates diverse cellular pathways and proteins. Ubiquitin is transferred to a target protein through a concerted action of a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme (E2), such as UBE2T, and a ubiquitin ligase (E3) (Machida et al., 2006 [PubMed 16916645]).[supplied by OMIM, Mar 2008].
More information related to gene Ube2t.
Products related to Ube2t Gene:
108 Products
Type
  • 104
  • 4
Species
  • 44
  • 30
  • 28
  • 2
  • 2
Application
  • 60
  • 30
  • 23
  • 16
  • 1
Fusion tag
  • 45
  • 15
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 36
  • 12
  • 9
  • 7
Insert
  • 42
  • 26
  • 20
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 41
  • 36
  • 22
  • 5
  • 2
Expression Type
  • 95
  • 51
  • 1
Selectable Marker
  • 27
  • 26
  • 1
  • 1
Promoter
  • 31
  • 30
  • 16
  • 12
  • 8
Format
  • 37
  • 27
  • 22
  • 22

Type:
ORF
Application:
Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Species:
Human
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Insert length:
594 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5741048
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
NCBI Accession:
NM_014176,NP_054895
Species:
Human
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Insert length:
594 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5403371
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
379797 (Xenopus laevis, Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843085
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
67196 (Mouse (Murine), Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3821075
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
505314 (Cow (Bovine), Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3854310
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
29089 (Human, Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090506
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
29089 (Human, Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090507
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
360847 (Rat (Rattus), Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4054722
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
Quantitative real-time PCR
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative)
Species:
Human
Synonyms:
PIG50, UBE2T, 2700084L22Rik, C80607, RGD1310816, hspc150, wu:fj86h11, zgc:153687
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193117
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
379797 (Xenopus laevis, Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843086
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
67196 (Mouse (Murine), Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3821076
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
505314 (Cow (Bovine), Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3854308
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
29089 (Human, Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090505
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
29089 (Human, Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090508
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
360847 (Rat (Rattus), Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4054721
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Gene ID:
29089 (Human, Ube2t)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Insert length:
594 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314072
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
NCBI Accession:
NM_001278115,NP_001265044
Species:
Mouse (Murine)
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Insert length:
615 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3338549
$210.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Species:
Human
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Insert length:
594 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4417742
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Species:
Human
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Insert length:
594 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4626299
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Ubiquitin-Conjugating Enzyme E2T (Putative) (Ube2t)
Species:
Human
Synonyms:
UBE2T, Ube2t, ube2t.S, ube2t
Insert length:
594 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4482828
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to Ube2t

  • ubiquitin conjugating enzyme E2 T (UBE2T)
  • ubiquitin-conjugating enzyme E2T (Ube2t)
  • ubiquitin conjugating enzyme E2T S homeolog (ube2t.S)
  • ubiquitin-conjugating enzyme E2T (putative) (ube2t)
  • ubiquitin conjugating enzyme E2 T (ube2t)
  • ubiquitin conjugating enzyme E2 T (Ube2t)
  • 2700084L22Rik
  • C80607
  • hspc150
  • PIG50
  • RGD1310816
  • UBE2T
  • wu:fj86h11
  • zgc:153687

Gene-IDs for different species

GENE IDSPECIES
29089 Homo sapiens
421149 Gallus gallus
505314 Bos taurus
457628 Pan troglodytes
607154 Canis lupus familiaris
67196 Mus musculus
360847 Rattus norvegicus
379797 Xenopus laevis
768152 Danio rerio
100286631 Salmo salar
100357338 Oryctolagus cuniculus
705911 Macaca mulatta
100730758 Cavia porcellus

Protein level used designations for Ube2t

  • HSPC150 protein similar to ubiquitin-conjugating enzyme
  • cell proliferation-inducing gene 50 protein
  • ubiquitin carrier protein T
  • ubiquitin conjugating enzyme
  • ubiquitin-conjugating enzyme E2 T
  • ubiquitin-protein ligase T
  • ubiquitin-conjugating enzyme E2T (putative)
  • ubiquitin-conjugating enzyme E2T
  • similar to Ubiquitin-conjugating enzyme E2 T (Ubiquitin-protein ligase T) (Ubiquitin carrier protein T)
Other products related to Ube2t such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com