A2ML1 (alpha-2-Macroglobulin-Like 1, A2ML1)

Short Description: This gene encodes a member of the alpha-macroglobulin superfamily. The encoded protein acts as an inhibitor for several proteases, and has been reported as the p170 antigen recognized by autoantibodies in the autoimmune disease paraneoplastic pemphigus (PNP\; PMID: 20805888). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012].
More information related to gene A2ML1.
Products related to A2ML1 Gene:
Type
  • 34
  • 1
Species
  • 33
  • 1
  • 1
Application
  • 22
  • 7
  • 7
  • 5
Fusion tag
  • 12
  • 5
  • 5
  • 4
  • 3
Vector Backbone
  • 4
  • 2
  • 2
  • 2
  • 2
Vector
  • 13
  • 12
  • 4
  • 3
  • 1
Insert
  • 11
  • 10
  • 6
  • 3
  • 2
Oligo-Type
  • 1
Resistance Gene
  • 15
  • 11
  • 6
  • 2
  • 2
Expression Type
  • 33
  • 17
Selectable Marker
  • 10
  • 9
Promoter
  • 11
  • 11
  • 5
  • 4
  • 4
Format
  • 15
  • 8
  • 7
  • 5
35 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Gene ID:
100189580 (Xenopus laevis, A2ML1)
Synonyms:
A2ML1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874627
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Gene ID:
100127688 (Xenopus tropicalis, A2ML1)
Synonyms:
A2ML1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873265
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Gene ID:
144568 (Human, A2ML1)
Synonyms:
A2ML1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3417585
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
NCBI Accession:
NM_144670
Species:
Human
Synonyms:
A2ML1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A2ML1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5170320
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Application:
RNA Interference
Gene:
alpha-2-Macroglobulin-Like 1
Species:
Human
Synonyms:
CPAMD9
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • A2ML1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3312487
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Gene ID:
144568 (Human, A2ML1)
Synonyms:
A2ML1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5049683

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5030738
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Species:
Human
Synonyms:
A2ML1
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5773643
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Species:
Human
Synonyms:
A2ML1
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5773642
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
NCBI Accession:
NM_144670
Species:
Human
Synonyms:
A2ML1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A2ML1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5285913
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
shRNA
Application:
RNA Interference
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Gene ID:
144568 (Human, A2ML1)
Synonyms:
A2ML1
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN4153510

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN4153509
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Species:
Human
Synonyms:
A2ML1
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948188

Components:
  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3711487
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Species:
Human
Synonyms:
A2ML1
Vector type:
Retroviral Vector
Vector backbone:
pGFP-V-RS
Resistance Gene:
Kanamycin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948187

Components:
  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3731826
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Species:
Human
Synonyms:
A2ML1
Vector type:
Retroviral Vector
Vector backbone:
pRS
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948189

Components:
  • Gene-specific shRNA expression pRS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3648919
$750.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Species:
Human
Synonyms:
A2ML1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5485084
$773.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Species:
Human
Synonyms:
A2ML1
Vector type:
Lentiviral Vector
Vector backbone:
pGFP-C-shLenti
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948186

Components:
  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3752164
$860.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Cloning
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
NCBI Accession:
NM_144670
Species:
Human
Synonyms:
A2ML1
Insert length:
4365 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5766730
$861.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
NCBI Accession:
NM_144670
Species:
Human
Synonyms:
A2ML1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of A2ML1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5170319
$920.00
3 x 300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
NCBI Accession:
NM_001282424,NP_001269353
Species:
Human
Synonyms:
A2ML1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308180
$980.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
NCBI Accession:
NM_144670,NP_653271
Species:
Human
Synonyms:
A2ML1
Insert length:
4365 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5485083
$1,174.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
alpha-2-Macroglobulin-Like 1 (A2ML1)
Species:
Human
Synonyms:
A2ML1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • A2ML1 gRNA vector 1 in pCAS-Guide vector.
  • A2ML1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3244787
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to A2ML1

  • alpha-2-macroglobulin like 1 (A2ML1)
  • CPAMD9

Gene-IDs for different species

GENE IDSPECIES
144568 Homo sapiens

Protein level used designations for A2ML1

  • C3 and PZP-like, alpha-2-macroglobulin domain containing 9
  • alpha-2-macroglobulin-like protein 1
Other products related to A2ML1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com