ABHD11 (Abhydrolase Domain Containing 11, ABHD11)

Short Description: This gene encodes a protein containing an alpha/beta hydrolase fold domain. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008].
More information related to gene ABHD11.
Products related to ABHD11 Gene:
Data Quality
  • 1
  • 118
  • 2
  • 59
  • 54
  • 2
  • 2
  • 1
  • 82
  • 25
  • 14
  • 12
Fusion tag
  • 39
  • 16
  • 16
  • 11
  • 6
Vector Backbone
  • 9
  • 9
  • 9
  • 4
  • 4
  • 52
  • 35
  • 12
  • 7
  • 6
  • 53
  • 41
  • 12
  • 6
  • 4
  • 2
Resistance Gene
  • 51
  • 38
  • 24
  • 5
  • 2
Expression Type
  • 95
  • 43
  • 13
  • 1
Selectable Marker
  • 28
  • 18
  • 13
  • 1
  • 42
  • 29
  • 20
  • 15
  • 6
  • 57
  • 27
  • 19
  • 17
120 Products

Abhydrolase Domain Containing 11 (ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
948 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5746238
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Abhydrolase Domain Containing 11 (ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5420149
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
446169 (Zebrafish (Danio rerio), ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4042484
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
446169 (Zebrafish (Danio rerio), ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4042485
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 11 (ABHD11)
NCBI Accession:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545855
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
83451 (Human, ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3469920
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
83451 (Human, ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3827552
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
779475 (Xenopus tropicalis, ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4031128
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
735011 (Xenopus laevis, ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4068768
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
68758 (Mouse, ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3822644
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
510109 (Cow, ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3856718
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
83451 (Human, ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
399 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5313884
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Abhydrolase Domain Containing 11 (ABHD11)
NCBI Accession:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
924 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308371
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Abhydrolase Domain Containing 11 (ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
948 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696813
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 11 (ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
948 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825942
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 11 (ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
948 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372129
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 11 (ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
948 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758037
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 11 (ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
948 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372560
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 11 (ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
948 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432757
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
83451 (Human, ABHD11)
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3395173
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD11

  • abhydrolase domain containing 11 (Abhd11)
  • abhydrolase domain containing 11 (ABHD11)
  • abhydrolase domain containing 11 (abhd11)
  • abhydrolase domain containing 11 (LOC732867)
  • abhydrolase domain containing 11 L homeolog (abhd11.L)
  • 1110054D16Rik
  • A630008N09Rik
  • Abhd11l1
  • pp1226
  • Wbscr21
  • wbscr21
  • WBSCR21
  • Wbscr21l

Gene-IDs for different species

360831 Rattus norvegicus
417473 Gallus gallus
446169 Danio rerio
472412 Pan troglodytes
489803 Canis lupus familiaris
779475 Xenopus (Silurana) tropicalis
732867 Bombyx mori
83451 Homo sapiens
68758 Mus musculus
510109 Bos taurus
735011 Xenopus laevis
100726390 Cavia porcellus
101112190 Ovis aries

Protein level used designations for ABHD11

  • Williams Beuren syndrome chromosome region 21
  • abhydrolase domain containing 11-like 1
  • abhydrolase domain containing 11
  • abhydrolase domain-containing protein 11
  • alpha/beta hydrolase domain-containing protein 11
  • williams-Beuren syndrome chromosomal region 21 protein homolog
  • williams-Beuren syndrome chromosomal region 21 protein
  • Williams-Beuren syndrome chromosomal region 21 protein homolog
  • Williams-Beuren syndrome critical region 21
Other products related to ABHD11 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com