ABHD11 (Abhydrolase Domain Containing 11, ABHD11)

Short Description: This gene encodes a protein containing an alpha/beta hydrolase fold domain. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008].
More information related to gene ABHD11.
Products related to ABHD11 Gene:
130 Products
Data Quality
  • 1
Type
  • 126
  • 4
Species
  • 63
  • 57
  • 2
  • 2
  • 2
Oligo-Type
  • 4
Insert
  • 53
  • 47
  • 14
  • 6
  • 4
Vector
  • 59
  • 35
  • 12
  • 8
  • 6
Vector Backbone
  • 9
  • 9
  • 9
  • 6
  • 4
Fusion tag
  • 47
  • 18
  • 16
  • 11
  • 6
Resistance Gene
  • 53
  • 44
  • 24
  • 5
  • 2
Selectable Marker
  • 30
  • 18
  • 13
  • 1
Promoter
  • 44
  • 34
  • 22
  • 15
  • 6
Expression Type
  • 102
  • 45
  • 13
  • 2
Application
  • 87
  • 31
  • 18
  • 12
Format
  • 61
  • 27
  • 23
  • 19
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Species:
Human
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5746238
$45.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus abhydrolase domain containing 11

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
NCBI Accession:
NM_145215
Species:
Mouse (Murine)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545855
$75.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Danio rerio abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
446169 (Zebrafish (Danio rerio), ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4042484
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
779475 (Xenopus tropicalis, ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031127
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
68758 (Mouse (Murine), ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822645
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
83451 (Human, ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827553
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
510109 (Cow (Bovine), ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856717
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
83451 (Human, ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469919
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
735011 (Xenopus laevis, ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4068767
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
446169 (Zebrafish (Danio rerio), ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4042485
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
779475 (Xenopus tropicalis, ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031128
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
68758 (Mouse (Murine), ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822644
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
83451 (Human, ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827552
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
510109 (Cow (Bovine), ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856718
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
83451 (Human, ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469920
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis abhydrolase domain containing 11 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
735011 (Xenopus laevis, ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4068768
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Gene ID:
83451 (Human, ABHD11)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
399 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313884
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABHD11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
NCBI Accession:
NM_001301058,NP_001287987
Species:
Human
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308373
€168.14
10 μg
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Abhd11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
NCBI Accession:
NM_145215,NP_660250
Species:
Mouse (Murine)
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
924 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308371
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD11 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 11 (ABHD11)
Species:
Human
Synonyms:
Abhd11, ABHD11, abhd11, LOC732867, abhd11.L
Insert length:
948 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696813
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD11

  • abhydrolase domain containing 11 (Abhd11)
  • abhydrolase domain containing 11 (ABHD11)
  • abhydrolase domain containing 11 (abhd11)
  • abhydrolase domain containing 11 (LOC732867)
  • abhydrolase domain containing 11 L homeolog (abhd11.L)
  • 1110054D16Rik
  • A630008N09Rik
  • Abhd11l1
  • pp1226
  • Wbscr21
  • wbscr21
  • WBSCR21
  • Wbscr21l

Gene-IDs for different species

GENE IDSPECIES
360831 Rattus norvegicus
417473 Gallus gallus
446169 Danio rerio
472412 Pan troglodytes
489803 Canis lupus familiaris
779475 Xenopus (Silurana) tropicalis
732867 Bombyx mori
83451 Homo sapiens
68758 Mus musculus
510109 Bos taurus
735011 Xenopus laevis
100726390 Cavia porcellus
101112190 Ovis aries

Protein level used designations for ABHD11

  • Williams Beuren syndrome chromosome region 21
  • abhydrolase domain containing 11-like 1
  • abhydrolase domain containing 11
  • abhydrolase domain-containing protein 11
  • alpha/beta hydrolase domain-containing protein 11
  • williams-Beuren syndrome chromosomal region 21 protein homolog
  • williams-Beuren syndrome chromosomal region 21 protein
  • Williams-Beuren syndrome chromosomal region 21 protein homolog
  • Williams-Beuren syndrome critical region 21
Other products related to ABHD11 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com