ABHD12 (Abhydrolase Domain Containing 12, ABHD12)

Short Description: This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011].
More information related to gene ABHD12.
Products related to ABHD12 Gene:
Data Quality
  • 1
  • 96
  • 2
  • 42
  • 27
  • 25
  • 2
  • 1
  • 57
  • 23
  • 20
  • 16
Fusion tag
  • 33
  • 16
  • 13
  • 9
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
  • 40
  • 28
  • 12
  • 9
  • 4
  • 34
  • 28
  • 18
  • 8
  • 6
  • 2
Resistance Gene
  • 36
  • 31
  • 23
  • 6
  • 2
Expression Type
  • 92
  • 47
Selectable Marker
  • 26
  • 21
  • 1
  • 33
  • 28
  • 14
  • 10
  • 8
  • 33
  • 27
  • 24
  • 14
98 Products

Abhydrolase Domain Containing 12 (ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1215 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5720081
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 12 (ABHD12)
Gene ID:
100216158 (Xenopus tropicalis, ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3874766
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 12 (ABHD12)
Gene ID:
26090 (Human, ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4090162
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 12 (ABHD12)
Gene ID:
499913 (Rat, ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4060697
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 12 (ABHD12)
Gene ID:
76192 (Mouse, ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3825797
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 12 (ABHD12)
Gene ID:
768242 (Cow, ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3869270
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 12 (ABHD12)
Gene ID:
26090 (Human, ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1215 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5323189
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Abhydrolase Domain Containing 12 (ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1215 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696814
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 12 (ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1215 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825943
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 12 (ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1215 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372130
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 12 (ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1215 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758038
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 12 (ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1215 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372561
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 12 (ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1215 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432758
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 12 (ABHD12)
Gene ID:
26090 (Human, ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3395736
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Abhydrolase Domain Containing 12 (ABHD12)
Gene ID:
26090 (Human, ABHD12)
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3429546
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 12 (ABHD12)
NCBI Accession:
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd12
Viral Particles
-80 °C
Catalog No. ABIN5082432
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 12 (ABHD12)
NCBI Accession:
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD12
Viral Particles
-80 °C
Catalog No. ABIN5082430
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 12 (ABHD12)
NCBI Accession:
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd12
Viral Particles
-80 °C
Catalog No. ABIN5082434
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
Abhydrolase Domain Containing 12 (ABHD12)
NCBI Accession:
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1197 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5334639
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Protein Expression
Abhydrolase Domain Containing 12 (ABHD12)
NCBI Accession:
ABHD12, CC1G_02966, PTRG_02160, abhd12.S, Abhd12
Insert length:
1197 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308374
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD12

  • abhydrolase domain containing 12 (ABHD12)
  • abhydrolase domain containing 12 (CC1G_02966)
  • abhydrolase domain containing 12 (PTRG_02160)
  • abhydrolase domain containing 12 S homeolog (abhd12.S)
  • abhydrolase domain containing 12 (Abhd12)
  • 1500011G07Rik
  • 6330583M11Rik
  • ABHD12
  • ABHD12A
  • AI431047
  • AW547313
  • BEM46L2
  • C20orf22
  • dJ965G21.2

Gene-IDs for different species

477004 Canis lupus familiaris
744997 Pan troglodytes
6012413 Coprinopsis cinerea okayama7130
6339600 Pyrenophora tritici-repentis Pt-1C-BFP
100380988 Xenopus laevis
100449601 Pongo abelii
100466451 Ailuropoda melanoleuca
100342158 Oryctolagus cuniculus
76192 Mus musculus
499913 Rattus norvegicus
26090 Homo sapiens
768242 Bos taurus
421249 Gallus gallus

Protein level used designations for ABHD12

  • abhydrolase domain containing 12
  • monoacylglycerol lipase ABHD12-like
  • 2-arachidonoylglycerol hydrolase
  • abhydrolase domain-containing protein 12
  • monoacylglycerol lipase ABHD12
Other products related to ABHD12 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com