ABHD5 (Abhydrolase Domain Containing 5, ABHD5)

Short Description: The protein encoded by this gene belongs to a large family of proteins defined by an alpha/beta hydrolase fold, and contains three sequence motifs that correspond to a catalytic triad found in the esterase/lipase/thioesterase subfamily. It differs from other members of this subfamily in that its putative catalytic triad contains an asparagine instead of the serine residue. Mutations in this gene have been associated with Chanarin-Dorfman syndrome, a triglyceride storage disease with impaired long-chain fatty acid oxidation. [provided by RefSeq, Jul 2008].
More information related to gene ABHD5.
Products related to ABHD5 Gene:
118 Products
Type
  • 112
  • 6
Species
  • 56
  • 29
  • 27
  • 2
  • 2
Oligo-Type
  • 5
  • 1
Insert
  • 38
  • 37
  • 21
  • 8
  • 6
Vector
  • 47
  • 36
  • 12
  • 9
  • 4
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Fusion tag
  • 43
  • 16
  • 11
  • 10
  • 8
Resistance Gene
  • 47
  • 42
  • 18
  • 5
  • 2
Selectable Marker
  • 26
  • 25
  • 13
  • 1
Promoter
  • 31
  • 31
  • 29
  • 13
  • 8
Expression Type
  • 94
  • 51
  • 13
Application
  • 70
  • 27
  • 26
  • 16
  • 1
Format
  • 51
  • 27
  • 22
  • 18
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Species:
Human
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720091
€39.82
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens abhydrolase domain containing 5.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Species:
Human
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545870
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 5
Species:
Human
Synonyms:
ABHD5, cds, cgi58, iecn2, ncie2, abhd5, CDS, CGI58, IECN2, NCIE2, 1300003D03Rik, 2010002J10Rik, CGI-58, IECN5
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191201
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
51099 (Human, ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3814188
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
67469 (Mouse (Murine), ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3821399
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
446400 (Xenopus laevis, ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884038
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
535588 (Cow (Bovine), ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3862971
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
549643 (Xenopus tropicalis, ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065541
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
51099 (Human, ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3814186
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
67469 (Mouse (Murine), ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3821400
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
446400 (Xenopus laevis, ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884037
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
535588 (Cow (Bovine), ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3862972
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis abhydrolase domain containing 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
549643 (Xenopus tropicalis, ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065540
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABHD5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
NCBI Accession:
NM_016006,NP_057090
Species:
Human
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Insert length:
2760 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382318
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABHD5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
NCBI Accession:
NM_016006,NP_057090
Species:
Human
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3318604
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Gene ID:
51099 (Human, ABHD5)
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312166
€172.15
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Mammalian expression of Human ABHD5 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Species:
Human
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Insert length:
1050 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4471670
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD5 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Species:
Human
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Insert length:
1050 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696822
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD5 with His tag

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Species:
Human
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Insert length:
1050 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758045
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD5 with His-GST

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 5 (ABHD5)
Species:
Human
Synonyms:
ABHD5, abhd5, abhd5a, Abhd5, abhd5.L
Insert length:
1050 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825951
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD5

  • abhydrolase domain containing 5 (ABHD5)
  • abhydrolase domain containing 5 (abhd5)
  • abhydrolase domain containing 5a (abhd5a)
  • abhydrolase domain containing 5 (Abhd5)
  • abhydrolase domain containing 5 L homeolog (abhd5.L)
  • 1300003D03Rik
  • 2010002J10Rik
  • ABHD5
  • abhd5
  • cds
  • CDS
  • CGI-58
  • cgi58
  • CGI58
  • iecn2
  • IECN2
  • IECN5
  • ncie2
  • NCIE2

Gene-IDs for different species

GENE IDSPECIES
460303 Pan troglodytes
549643 Xenopus (Silurana) tropicalis
566493 Danio rerio
100066775 Equus caballus
100229229 Taeniopygia guttata
100350162 Oryctolagus cuniculus
100125355 Ovis aries
51099 Homo sapiens
67469 Mus musculus
485570 Canis lupus familiaris
497624 Sus scrofa
535588 Bos taurus
316122 Rattus norvegicus
446400 Xenopus laevis
420673 Gallus gallus
100174407 Pongo abelii

Protein level used designations for ABHD5

  • abhydrolase domain containing 5
  • CGI58 protein
  • 1-acylglycerol-3-phosphate O-acyltransferase ABHD5
  • abhydrolase domain-containing protein 5
  • lipid droplet-binding protein CGI-58
  • alpha/beta hydrolase domain-containing 5
  • lipid droplet binding protein
  • Abhydrolase domain-containing protein 5
Other products related to ABHD5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com