Acad8 (Acyl-CoA Dehydrogenase Family, Member 8, Acad8)

Short Description: This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. The encoded protein is a mitochondrial enzyme that functions in catabolism of the branched-chain amino acid valine. Defects in this gene are the cause of isobutyryl-CoA dehydrogenase deficiency.[provided by RefSeq, Nov 2009].
More information related to gene Acad8.
Products related to Acad8 Gene:
105 Products
Type
  • 99
  • 6
Species
  • 54
  • 45
  • 2
  • 2
  • 1
Oligo-Type
  • 4
  • 2
Insert
  • 42
  • 31
  • 14
  • 6
  • 4
Vector
  • 51
  • 24
  • 8
  • 6
  • 5
Vector Backbone
  • 4
  • 4
  • 4
  • 4
  • 4
Fusion tag
  • 38
  • 11
  • 10
  • 7
  • 6
Resistance Gene
  • 48
  • 34
  • 14
  • 3
  • 2
Selectable Marker
  • 26
  • 18
  • 18
Promoter
  • 37
  • 22
  • 21
  • 9
  • 6
Expression Type
  • 65
  • 35
  • 26
Application
  • 65
  • 23
  • 18
  • 12
  • 2
Format
  • 58
  • 18
  • 15
  • 14
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Species:
Human
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5746586
$45.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens acyl-CoA dehydrogenase family, member 8.

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Species:
Human
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545884
$75.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus acyl-Coenzyme A dehydrogenase family, member 8.

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
NCBI Accession:
NM_025862
Species:
Mouse (Murine)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545885
$75.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Rattus norvegicus acyl-CoA dehydrogenase family, member 8

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
NCBI Accession:
XM_003754394
Species:
Rat (Rattus)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545886
$75.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Acyl-CoA Dehydrogenase Family, Member 8
Species:
Mouse (Murine)
Synonyms:
zgc:55874, DDBDRAFT_0219367, DDBDRAFT_0237710, DDB_0219367, DDB_0237710, ACAD-8, ARC42, RGD1564209, 2310016C19Rik, AI786953
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195132
$79.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Acyl-CoA Dehydrogenase Family, Member 8
Species:
Human
Synonyms:
zgc:55874, DDBDRAFT_0219367, DDBDRAFT_0237710, DDB_0219367, DDB_0237710, ACAD-8, ARC42, RGD1564209, 2310016C19Rik, AI786953
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191184
$79.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Xenopus laevis acyl-CoA dehydrogenase family, member 8 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Gene ID:
379604 (Xenopus laevis, Acad8)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041095
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus acyl-Coenzyme A dehydrogenase family, member 8 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Gene ID:
66948 (Mouse (Murine), Acad8)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3820710
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens acyl-CoA dehydrogenase family, member 8 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Gene ID:
27034 (Human, Acad8)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812773
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus acyl-CoA dehydrogenase family, member 8 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Gene ID:
512070 (Cow (Bovine), Acad8)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062430
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis acyl-CoA dehydrogenase family, member 8 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Gene ID:
379604 (Xenopus laevis, Acad8)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041094
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus acyl-Coenzyme A dehydrogenase family, member 8 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Gene ID:
66948 (Mouse (Murine), Acad8)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3820711
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens acyl-CoA dehydrogenase family, member 8 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Gene ID:
27034 (Human, Acad8)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812772
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus acyl-CoA dehydrogenase family, member 8 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Gene ID:
512070 (Cow (Bovine), Acad8)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062429
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACAD8 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
NCBI Accession:
NM_014384,NP_055199
Species:
Human
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Insert length:
2340 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382325
$190.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Gene ID:
27034 (Human, Acad8)
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Insert length:
1248 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312378
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Mammalian expression of Human ACAD8 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Species:
Human
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Insert length:
1248 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4471687
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACAD8 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Species:
Human
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Insert length:
1248 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696847
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACAD8 with His tag

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Species:
Human
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Insert length:
1248 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758062
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACAD8 with His-GST

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase Family, Member 8 (Acad8)
Species:
Human
Synonyms:
acad8.L, acad8, ACAD8, LOC100231097, Acad8
Insert length:
1248 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825976
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to Acad8

  • acyl-CoA dehydrogenase family member 8 L homeolog (acad8.L)
  • acyl-CoA dehydrogenase family, member 8 (acad8)
  • acyl-CoA dehydrogenase family member 8 (ACAD8)
  • acyl-CoA dehydrogenase (acad8)
  • acyl-Coenzyme A dehydrogenase family, member 8 (LOC100231097)
  • acyl-CoA dehydrogenase family, member 8 (Acad8)
  • acyl-Coenzyme A dehydrogenase family, member 8 (Acad8)
  • 2310016C19Rik
  • ACAD-8
  • AI786953
  • ARC42
  • DDBDRAFT_0219367
  • DDBDRAFT_0237710
  • DDB_0219367
  • DDB_0237710
  • RGD1564209
  • zgc:55874

Gene-IDs for different species

GENE IDSPECIES
379604 Xenopus laevis
394130 Danio rerio
419739 Gallus gallus
451683 Pan troglodytes
479386 Canis lupus familiaris
677723 Macaca mulatta
8626731 Dictyostelium discoideum AX4
100231097 Taeniopygia guttata
100346240 Oryctolagus cuniculus
100385977 Callithrix jacchus
27034 Homo sapiens
367196 Rattus norvegicus
512070 Bos taurus
66948 Mus musculus

Protein level used designations for Acad8

  • acyl-Coenzyme A dehydrogenase family, member 8
  • isobutyryl-CoA dehydrogenase, mitochondrial
  • acyl-coenzyme A dehydrogenase family, member 8
  • acyl-Coenzyme A dehydrogenase family member 8
  • acyl-CoA dehydrogenase family, member 8
  • isobutyryl-CoA dehydrogenase, mitochondrial-like
  • activator-recruited cofactor 42 kDa component
  • ACAD-8
  • acyl-CoA dehydrogenase family member 8
Other products related to Acad8 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com