ACER3 (Alkaline Ceramidase 3, ACER3)

Short Description: Hydrolyzes only phytoceramide into phytosphingosine and free fatty acid. Does not have reverse activity (By similarity).
More information related to gene ACER3.
Products related to ACER3 Gene:
100 Products
Type
  • 96
  • 4
Species
  • 59
  • 35
  • 2
  • 2
  • 2
Oligo-Type
  • 4
Insert
  • 37
  • 33
  • 14
  • 6
  • 4
Vector
  • 49
  • 27
  • 8
  • 6
  • 3
Vector Backbone
  • 9
  • 5
  • 5
  • 4
  • 4
Fusion tag
  • 37
  • 12
  • 11
  • 8
  • 6
Resistance Gene
  • 41
  • 36
  • 14
  • 5
  • 2
Selectable Marker
  • 23
  • 18
  • 13
  • 1
Promoter
  • 32
  • 28
  • 22
  • 9
  • 6
Expression Type
  • 79
  • 37
  • 13
  • 2
Application
  • 66
  • 22
  • 18
  • 12
Format
  • 51
  • 18
  • 16
  • 15
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5736666
$45.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alkaline ceramidase 3.

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545903
$75.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see
ISO 9001:2008

Expression/transfection ready cDNA ORF clone of Human ACER3 with C terminal DYKDDDDK tag is ideal for express proteins in E.coli & mammalian cells.

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_001300954
Gene ID:
55331 (Human, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Insert length:
519 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4933642
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
495272 (Xenopus laevis, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983135
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
100127611 (Xenopus tropicalis, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028227
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
66190 (Mouse (Murine), ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819773
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
55331 (Human, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3816244
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
615110 (Cow (Bovine), ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4067070
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
495272 (Xenopus laevis, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983136
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
100127611 (Xenopus tropicalis, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028226
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
66190 (Mouse (Murine), ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819774
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
55331 (Human, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3816245
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus alkaline ceramidase 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
615110 (Cow (Bovine), ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4067071
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACER3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_001300955,NP_001287884
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308524
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACER3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_001300954,NP_001287883
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308523
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alkaline ceramidase 3 with N terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611676
$195.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alkaline ceramidase 3 with C terminal Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611667
$195.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alkaline ceramidase 3 with N terminal Myc tag.

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611677
$195.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alkaline ceramidase 3.

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611679
$195.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alkaline ceramidase 3 with C terminal HA tag.

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611669
$195.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ACER3

  • alkaline ceramidase 3 S homeolog (acer3.S)
  • alkaline ceramidase 3 (ACER3)
  • alkaline ceramidase 3 (acer3)
  • alkaline ceramidase 3 (Acer3)
  • 1110057L18Rik
  • 5430429L08Rik
  • APHC
  • AV015045
  • phca
  • PHCA
  • Phca
  • RGD1561254

Gene-IDs for different species

GENE IDSPECIES
495272 Xenopus laevis
607939 Canis lupus familiaris
615110 Bos taurus
748831 Pan troglodytes
100127611 Xenopus (Silurana) tropicalis
697832 Macaca mulatta
55331 Homo sapiens
66190 Mus musculus
499210 Rattus norvegicus

Protein level used designations for ACER3

  • phytoceramidase, alkaline
  • alkCDase 3
  • alkaline CDase 3
  • alkaline dihydroceramidase SB89
  • alkaline phytoceramidase
  • aPHC
Other products related to ACER3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com