ACER3 (Alkaline Ceramidase 3, ACER3)

Short Description: Hydrolyzes only phytoceramide into phytosphingosine and free fatty acid. Does not have reverse activity (By similarity).
More information related to gene ACER3.
Products related to ACER3 Gene:
100 Products
Type
  • 96
  • 4
Species
  • 59
  • 35
  • 2
  • 2
  • 2
Application
  • 66
  • 22
  • 18
  • 12
Fusion tag
  • 37
  • 12
  • 11
  • 8
  • 6
Vector Backbone
  • 9
  • 5
  • 5
  • 4
  • 4
Vector
  • 49
  • 27
  • 8
  • 6
  • 3
Insert
  • 37
  • 33
  • 14
  • 6
  • 4
Oligo-Type
  • 4
Resistance Gene
  • 41
  • 36
  • 14
  • 5
  • 2
Expression Type
  • 79
  • 37
  • 13
  • 2
Selectable Marker
  • 23
  • 18
  • 13
  • 1
Promoter
  • 32
  • 28
  • 22
  • 9
  • 6
Format
  • 51
  • 18
  • 16
  • 15
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5736666
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_001300954
Gene ID:
55331 (Human, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Insert length:
519 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4933642
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
100127611 (Xenopus tropicalis, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028227
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
495272 (Xenopus laevis, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983135
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
615110 (Cow (Bovine), ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4067070
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
55331 (Human, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3816244
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
66190 (Mouse (Murine), ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819773
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545903
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
100127611 (Xenopus tropicalis, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028226
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
55331 (Human, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3816245
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
66190 (Mouse (Murine), ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819774
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
495272 (Xenopus laevis, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983136
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
615110 (Cow (Bovine), ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4067071
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Alkaline Ceramidase 3 (ACER3)
Gene ID:
55331 (Human, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Insert length:
804 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5322111
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Gene ID:
55331 (Human, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Insert length:
804 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4933641
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_001300953
Gene ID:
55331 (Human, ACER3)
Synonyms:
acer3.S, ACER3, acer3, Acer3
Insert length:
693 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4933640
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611667
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611676
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611669
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 3 (ACER3)
NCBI Accession:
NM_018367
Species:
Human
Synonyms:
acer3.S, ACER3, acer3, Acer3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611670
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ACER3

  • alkaline ceramidase 3 S homeolog (acer3.S)
  • alkaline ceramidase 3 (ACER3)
  • alkaline ceramidase 3 (acer3)
  • alkaline ceramidase 3 (Acer3)
  • 1110057L18Rik
  • 5430429L08Rik
  • APHC
  • AV015045
  • phca
  • PHCA
  • Phca
  • RGD1561254

Gene-IDs for different species

GENE IDSPECIES
495272 Xenopus laevis
607939 Canis lupus familiaris
615110 Bos taurus
748831 Pan troglodytes
100127611 Xenopus (Silurana) tropicalis
697832 Macaca mulatta
55331 Homo sapiens
66190 Mus musculus
499210 Rattus norvegicus

Protein level used designations for ACER3

  • phytoceramidase, alkaline
  • alkCDase 3
  • alkaline CDase 3
  • alkaline dihydroceramidase SB89
  • alkaline phytoceramidase
  • aPHC
Other products related to ACER3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com