Claudin 1 (Claudin 1, CLDN1)

Short Description: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. Loss of function mutations result in neonatal ichthyosis-sclerosing cholangitis syndrome. [provided by RefSeq, Jul 2008].
More information related to gene Claudin 1.
Products related to Claudin 1 Gene:
Data Quality
  • 1
Type
  • 127
  • 4
Species
  • 51
  • 41
  • 29
  • 4
  • 2
Application
  • 86
  • 35
  • 21
  • 16
  • 1
Fusion tag
  • 48
  • 13
  • 13
  • 10
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 62
  • 35
  • 12
  • 9
  • 5
Insert
  • 48
  • 45
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 56
  • 49
  • 18
  • 4
  • 2
Expression Type
  • 95
  • 47
  • 26
Selectable Marker
  • 26
  • 26
  • 22
Promoter
  • 42
  • 28
  • 28
  • 12
  • 8
Format
  • 59
  • 27
  • 22
  • 22
131 Products

Type:
ORF
Application:
Cloning
Gene:
Claudin 1 (CLDN1)
Species:
Human
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Insert length:
636 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5722523
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Claudin 1 (CLDN1)
NCBI Accession:
NM_021101,NP_066924
Species:
Human
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Insert length:
636 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5343829
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
9076 (Human, CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465781
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
12737 (Mouse (Murine), CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463222
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
379132 (Xenopus laevis, CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3841962
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
65129 (Rat (Rattus), CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879452
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
414922 (Cow (Bovine), CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848274
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
548421 (Xenopus tropicalis, CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065264
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Claudin 1 (CLDN1)
Species:
Human
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558589
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Claudin 1 (CLDN1)
NCBI Accession:
NM_016674
Species:
Mouse (Murine)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3558590
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Claudin 1 (CLDN1)
NCBI Accession:
NM_031699
Species:
Rat (Rattus)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558591
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Claudin 1
Species:
Human
Synonyms:
CLD1, ILVASC, SEMP1, AI596271, cldn19, claudin-1, cld1, ilvasc, semp1, CLDN1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191648
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
9076 (Human, CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465780
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
12737 (Mouse (Murine), CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463221
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
379132 (Xenopus laevis, CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3841963
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
65129 (Rat (Rattus), CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879451
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
414922 (Cow (Bovine), CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848275
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
548421 (Xenopus tropicalis, CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065263
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Claudin 1 (CLDN1)
Gene ID:
9076 (Human, CLDN1)
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Insert length:
636 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315614
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Claudin 1 (CLDN1)
Species:
Human
Synonyms:
CLDN1, Cldn1, cldn1, cldn1.S
Insert length:
636 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4435122
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to Claudin 1

  • claudin 1 (CLDN1)
  • claudin 1 (Cldn1)
  • claudin 1 (cldn1)
  • claudin 1 S homeolog (cldn1.S)
  • AI596271
  • claudin-1
  • CLD1
  • cld1
  • CLDN1
  • cldn19
  • ILVASC
  • ilvasc
  • SEMP1
  • semp1

Gene-IDs for different species

GENE IDSPECIES
9076 Homo sapiens
12737 Mus musculus
65129 Rattus norvegicus
81590 Danio rerio
379132 Xenopus laevis
414922 Bos taurus
460934 Pan troglodytes
548421 Xenopus (Silurana) tropicalis
608207 Canis lupus familiaris
780473 Ovis aries
100037713 Oryctolagus cuniculus
100625166 Sus scrofa
100732605 Cavia porcellus
424910 Gallus gallus
100059811 Equus caballus

Protein level used designations for Claudin 1

  • claudin-1
  • senescence-associated epithelial membrane protein 1
  • claudin 19
  • claudin 1
  • tight junction protein
Other products related to Claudin 1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com