COL1A1 (Collagen, Type I, alpha 1, COL1A1)

Short Description: This gene encodes the pro-alpha1 chains of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIA, Ehlers-Danlos syndrome Classical type, Caffey Disease and idiopathic osteoporosis. Reciprocal translocations between chromosomes 17 and 22, where this gene and the gene for platelet-derived growth factor beta are located, are associated with a particular type of skin tumor called dermatofibrosarcoma protuberans, resulting from unregulated expression of the growth factor. Two transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008].
More information related to gene COL1A1.
Products related to COL1A1 Gene:
Data Quality
  • 1
  • 110
  • 3
  • 38
  • 37
  • 24
  • 8
  • 2
  • 68
  • 40
  • 21
  • 16
Fusion tag
  • 52
  • 11
  • 9
  • 8
  • 6
  • 5
Vector Backbone
  • 12
  • 6
  • 6
  • 6
  • 4
  • 52
  • 27
  • 12
  • 9
  • 6
  • 51
  • 25
  • 18
  • 8
  • 6
  • 3
Resistance Gene
  • 53
  • 43
  • 10
  • 4
  • 2
Expression Type
  • 92
  • 46
  • 11
Selectable Marker
  • 26
  • 22
  • 11
  • 36
  • 28
  • 20
  • 12
  • 8
  • 40
  • 28
  • 27
  • 18
113 Products

Collagen, Type I, alpha 1 (COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Insert length:
4395 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5722637
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Collagen, Type I, alpha 1 (COL1A1)
NCBI Accession:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Insert length:
4395 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5344161
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Protein Expression
Collagen, Type I, alpha 1 (COL1A1)
NCBI Accession:
Gene ID:
1277 (Human, COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Insert length:
4395 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4947074
10 μg
Plus shipping costs $45.00
Will be delivered in 26 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
325675 (Zebrafish (Danio rerio), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3877092
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
325675 (Zebrafish (Danio rerio), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3877093
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
337158 (Zebrafish (Danio rerio), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3877265
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
337158 (Zebrafish (Danio rerio), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3877266
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
282187 (Cow (Bovine), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3839503
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
380515 (Xenopus laevis, COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3844400
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
12842 (Mouse (Murine), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3808129
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
12842 (Mouse (Murine), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3808132
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
29393 (Rat (Rattus), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4046207
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
496414 (Xenopus tropicalis, COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4059835
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
1277 (Human, COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4210842
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Collagen, Type I, alpha 1 (COL1A1)
NCBI Accession:
Mouse (Murine)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3558731
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Collagen, Type I, alpha 1 (COL1A1)
NCBI Accession:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3558732
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
337158 (Zebrafish (Danio rerio), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3841132
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
337158 (Zebrafish (Danio rerio), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3841133
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
325675 (Zebrafish (Danio rerio), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3840729
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
325675 (Zebrafish (Danio rerio), COL1A1)
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3840730
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to COL1A1

  • collagen type I alpha 1 chain (COL1A1)
  • collagen, type I, alpha 1 (Col1a1)
  • collagen type I alpha 1 chain (Col1a1)
  • collagen, type I, alpha 1 S homeolog (col1a1.S)
  • collagen alpha-1(I) chain (LOC397571)
  • collagen type I alpha 2 chain (COL1A2)
  • collagen, type I, alpha 1 (COL1A1)
  • collagen, type I, alpha 1a (col1a1a)
  • collagen 1a1 (col1a1)
  • collagen, type I, alpha 1b (col1a1b)
  • alpha1(I)
  • alpha3(I)
  • cb21
  • Col1a-1
  • col1a1
  • COL1A1
  • COL1A2
  • col1a3
  • Cola-1
  • Cola1
  • COLIA1
  • hm:zeh0348
  • MGC52532
  • Mov-13
  • Mov13
  • OI4
  • sb:cb21
  • sb:cb384
  • wu:fa95h05
  • wu:fa99c12
  • wu:fb02c06
  • wu:fd02a10
  • wu:fj59a10

Gene-IDs for different species

1277 Homo sapiens
12842 Mus musculus
29393 Rattus norvegicus
282187 Bos taurus
380515 Xenopus laevis
397571 Sus scrofa
403651 Canis lupus familiaris
443483 Ovis aries
455117 Pan troglodytes
574201 Macaca mulatta
100008952 Oryctolagus cuniculus
100033877 Equus caballus
337158 Danio rerio
100135778 Oncorhynchus mykiss
100733209 Cavia porcellus
395532 Gallus gallus
325675 Danio rerio

Protein level used designations for COL1A1

  • alpha-1 type I collagen
  • collagen alpha 1 chain type I
  • collagen alpha-1(I) chain
  • collagen alpha-1(I) chain preproprotein
  • collagen of skin, tendon and bone, alpha-1 chain
  • pro-alpha-1 collagen type 1
  • alpha-1 type 1 collagen
  • procollagen, type I, alpha 1
  • collagen, type 1, alpha 1
  • procollagen type I, alpha 1
  • procollagen, type 1, alpha 1
  • collagen, type I, alpha 1
  • type I collagen alpha 1 chain
  • type I collagen alpha1
  • type I collagen pre-pro-alpha1(I) chain
  • alpha 1 type I collagen
  • collagen, type I, alpha 2
  • collagen type I alpha 1
  • prepro-alpha-1 collagen type I
  • procollagen alpha 1 (I)
  • chi
  • chihuahua
  • med
  • microwaved
  • collagen 1a1
  • pro-alpha-1 type 1 collagen
  • alpha-1 collagen (I)
  • collagen alpha-1 chain
  • collagen, type I, alpha 1b
  • collagen, type I, alpha 3
  • fj59a10
Other products related to COL1A1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website