COL1A1 (Collagen, Type I, alpha 1, COL1A1)

Short Description: This gene encodes the pro-alpha1 chains of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIA, Ehlers-Danlos syndrome Classical type, Caffey Disease and idiopathic osteoporosis. Reciprocal translocations between chromosomes 17 and 22, where this gene and the gene for platelet-derived growth factor beta are located, are associated with a particular type of skin tumor called dermatofibrosarcoma protuberans, resulting from unregulated expression of the growth factor. Two transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008].
More information related to gene COL1A1.
Products related to COL1A1 Gene:
119 Products
Data Quality
  • 1
Type
  • 113
  • 6
Species
  • 40
  • 39
  • 26
  • 8
  • 2
Application
  • 68
  • 40
  • 27
  • 16
Fusion tag
  • 55
  • 12
  • 11
  • 8
  • 6
Vector Backbone
  • 12
  • 6
  • 6
  • 6
  • 4
Vector
  • 55
  • 27
  • 12
  • 9
  • 6
Insert
  • 51
  • 25
  • 21
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 53
  • 46
  • 10
  • 4
  • 2
Expression Type
  • 95
  • 49
  • 11
Selectable Marker
  • 26
  • 25
  • 11
Promoter
  • 36
  • 31
  • 23
  • 12
  • 8
Format
  • 46
  • 28
  • 27
  • 18

Type:
ORF
Application:
Protein Expression
Gene:
Collagen, Type I, alpha 1 (COL1A1)
NCBI Accession:
NM_000088,NP_000079
Species:
Human
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Insert length:
4395 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5344161
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Collagen, Type I, alpha 1 (COL1A1)
NCBI Accession:
NM_000088
Gene ID:
1277 (Human, COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Insert length:
4395 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4947074
$99.00
10 μg
Plus shipping costs $45.00
Will be delivered in 26 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
337158 (Zebrafish (Danio rerio), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877265
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
337158 (Zebrafish (Danio rerio), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877266
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
325675 (Zebrafish (Danio rerio), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877093
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
325675 (Zebrafish (Danio rerio), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877092
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
380515 (Xenopus laevis, COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3844400
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
12842 (Mouse (Murine), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808129
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
12842 (Mouse (Murine), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808132
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
282187 (Cow (Bovine), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839503
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
29393 (Rat (Rattus), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046207
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
496414 (Xenopus tropicalis, COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4059835
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
1277 (Human, COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210842
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
NCBI Accession:
NM_007742
Species:
Mouse (Murine)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558731
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
NCBI Accession:
NM_000088
Species:
Human
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558732
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
325675 (Zebrafish (Danio rerio), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840729
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
325675 (Zebrafish (Danio rerio), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840730
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
337158 (Zebrafish (Danio rerio), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3841132
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Gene ID:
337158 (Zebrafish (Danio rerio), COL1A1)
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3841133
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Collagen, Type I, alpha 1 (COL1A1)
Species:
Human
Synonyms:
COL1A1, Col1a1, col1a1.S, LOC397571, COL1A2, col1a1a, col1a1, col1a1b
Insert length:
4395 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5722637
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
  • <
  • 1

Synonyms and alternative names related to COL1A1

  • collagen type I alpha 1 chain (COL1A1)
  • collagen, type I, alpha 1 (Col1a1)
  • collagen type I alpha 1 chain (Col1a1)
  • collagen, type I, alpha 1 S homeolog (col1a1.S)
  • collagen alpha-1(I) chain (LOC397571)
  • collagen type I alpha 2 chain (COL1A2)
  • collagen, type I, alpha 1 (COL1A1)
  • collagen, type I, alpha 1a (col1a1a)
  • collagen 1a1 (col1a1)
  • collagen, type I, alpha 1b (col1a1b)
  • alpha1(I)
  • alpha3(I)
  • cb21
  • Col1a-1
  • col1a1
  • COL1A1
  • COL1A2
  • col1a3
  • Cola-1
  • Cola1
  • COLIA1
  • hm:zeh0348
  • MGC52532
  • Mov-13
  • Mov13
  • OI4
  • sb:cb21
  • sb:cb384
  • wu:fa95h05
  • wu:fa99c12
  • wu:fb02c06
  • wu:fd02a10
  • wu:fj59a10

Gene-IDs for different species

GENE IDSPECIES
1277 Homo sapiens
12842 Mus musculus
29393 Rattus norvegicus
282187 Bos taurus
380515 Xenopus laevis
397571 Sus scrofa
403651 Canis lupus familiaris
443483 Ovis aries
455117 Pan troglodytes
574201 Macaca mulatta
100008952 Oryctolagus cuniculus
100033877 Equus caballus
337158 Danio rerio
100135778 Oncorhynchus mykiss
100733209 Cavia porcellus
395532 Gallus gallus
325675 Danio rerio

Protein level used designations for COL1A1

  • alpha-1 type I collagen
  • collagen alpha 1 chain type I
  • collagen alpha-1(I) chain
  • collagen alpha-1(I) chain preproprotein
  • collagen of skin, tendon and bone, alpha-1 chain
  • pro-alpha-1 collagen type 1
  • alpha-1 type 1 collagen
  • procollagen, type I, alpha 1
  • collagen, type 1, alpha 1
  • procollagen type I, alpha 1
  • procollagen, type 1, alpha 1
  • collagen, type I, alpha 1
  • type I collagen alpha 1 chain
  • type I collagen alpha1
  • type I collagen pre-pro-alpha1(I) chain
  • alpha 1 type I collagen
  • collagen, type I, alpha 2
  • collagen type I alpha 1
  • prepro-alpha-1 collagen type I
  • procollagen alpha 1 (I)
  • chi
  • chihuahua
  • med
  • microwaved
  • collagen 1a1
  • pro-alpha-1 type 1 collagen
  • alpha-1 collagen (I)
  • collagen alpha-1 chain
  • collagen, type I, alpha 1b
  • collagen, type I, alpha 3
  • fj59a10
Other products related to COL1A1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com