DCP1B (DCP1 Decapping Enzyme Homolog B (S. Cerevisiae), DCP1B)

Short Description: DCP1B is a core component of the mRNA decapping complex, a key factor in the regulation of mRNA decay (Lykke-Andersen, 2002 [PubMed 12417715]).[supplied by OMIM, Mar 2008].
More information related to gene DCP1B.
Products related to DCP1B Gene:
86 Products
  • 82
  • 4
  • 50
  • 30
  • 2
  • 2
  • 2
  • 47
  • 24
  • 16
  • 12
  • 1
Fusion tag
  • 33
  • 10
  • 8
  • 7
  • 6
Vector Backbone
  • 4
  • 4
  • 4
  • 4
  • 4
  • 34
  • 24
  • 8
  • 8
  • 6
  • 31
  • 26
  • 13
  • 6
  • 4
  • 3
  • 1
Resistance Gene
  • 34
  • 33
  • 12
  • 3
  • 2
Expression Type
  • 61
  • 32
  • 13
Selectable Marker
  • 19
  • 18
  • 13
  • 21
  • 21
  • 19
  • 9
  • 6
  • 38
  • 18
  • 15
  • 15

Protein Expression, Cloning
DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
514548 (Cow (Bovine), DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3858898
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
446801 (Xenopus laevis, DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3851620
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
319618 (Mouse (Murine), DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4016411
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
319618 (Mouse (Murine), DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4016412
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
196513 (Human, DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470457
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Catalog No. ABIN3887899
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
DCP1 Decapping Enzyme Homolog B (S. Cerevisiae)
DCP1, hDcp1b, B930050E02Rik, RGD1562214, dcp1, dcp1b, mitc1l, si:ch211-87p6none
-20 °C
Catalog No. ABIN3192152
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Insert length:
1857 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5751951
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
514548 (Cow (Bovine), DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3858900
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
446801 (Xenopus laevis, DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3851621
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
319618 (Mouse (Murine), DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4016414
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
319618 (Mouse (Murine), DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4016413
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
196513 (Human, DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470458
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
Gene ID:
196513 (Human, DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Insert length:
1857 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5319688
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
NCBI Accession:
DCP1B, Dcp1b, dcp1b.L, dcp1b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3389248
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Insert length:
1857 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4700826
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Insert length:
1857 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4760937
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Insert length:
1857 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4766230
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Insert length:
1857 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4435657
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
DCP1 Decapping Enzyme Homolog B (S. Cerevisiae) (DCP1B)
DCP1B, Dcp1b, dcp1b.L, dcp1b
Insert length:
1857 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4474562
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to DCP1B

  • decapping mRNA 1B (DCP1B)
  • decapping mRNA 1B (Dcp1b)
  • decapping mRNA 1B L homeolog (dcp1b.L)
  • decapping mRNA 1B (dcp1b)
  • B930050E02Rik
  • DCP1
  • dcp1
  • dcp1b
  • hDcp1b
  • mitc1l
  • RGD1562214
  • si:ch211-87p6none

Gene-IDs for different species

196513 Homo sapiens
100174754 Pongo abelii
319618 Mus musculus
500305 Rattus norvegicus
772197 Gallus gallus
477734 Canis lupus familiaris
514548 Bos taurus
101789290 Cavia porcellus
446801 Xenopus laevis
568176 Danio rerio

Protein level used designations for DCP1B

  • DCP1 decapping enzyme homolog B
  • decapping enzyme hDcp1b
  • mRNA-decapping enzyme 1B
  • DCP1 decapping enzyme homolog b
  • decapping mRNA 1B L homeolog
  • MAD homolog 4 interacting transcription coactivator 1, like
Other products related to DCP1B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com