EXD3 (Exonuclease 3'-5' Domain Containing 3, EXD3)

Short Description: Represses the transposition of Tc1, Tc3, Tc4, and Tc5, perhaps by degrading transposon-specific messages. Also affects sperm development, sensitivity to RNAi of mainly germline expressed genes, silencing of some germline transgenes, X chromosome loss, and is required for cosuppression (functional silencing of chromosomal loci induced by transgenes) and for silencing induced by antisense RNA oligomers.
More information related to gene EXD3.
Products related to EXD3 Gene:
48 Products
Type
  • 46
  • 2
Species
  • 48
Application
  • 24
  • 12
  • 9
  • 7
Fusion tag
  • 15
  • 6
  • 5
  • 4
  • 4
Vector Backbone
  • 4
  • 3
  • 2
  • 2
  • 2
Vector
  • 18
  • 12
  • 8
  • 3
  • 3
Insert
  • 19
  • 13
  • 7
  • 3
  • 2
Oligo-Type
  • 2
Resistance Gene
  • 22
  • 15
  • 5
  • 4
  • 2
Expression Type
  • 43
  • 25
Selectable Marker
  • 16
  • 10
  • 1
Promoter
  • 16
  • 12
  • 9
  • 5
  • 4
Format
  • 20
  • 18
  • 6
  • 4
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5750186
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5750187
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Gene ID:
54932 (Human, EXD3)
Synonyms:
EXD3, mut-7
Insert length:
741 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320890
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Gene ID:
54932 (Human, EXD3)
Synonyms:
EXD3, mut-7
Insert length:
759 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315811
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
NCBI Accession:
NM_001286823
Gene ID:
54932 (Human, EXD3)
Synonyms:
EXD3, mut-7
Insert length:
741 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4929995
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
1600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3389507
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
NCBI Accession:
NM_001286823,NP_001273752
Species:
Human
Synonyms:
EXD3, mut-7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292101
$300.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4766960
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4766959
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
741 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4701880
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4701881
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4761666
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4761667
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4436386
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4436387
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475291
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475292
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
690 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4831011
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Species:
Human
Synonyms:
EXD3, mut-7
Insert length:
741 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4831010
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Exonuclease 3'-5' Domain Containing 3 (EXD3)
Gene ID:
54932 (Human, EXD3)
Synonyms:
EXD3, mut-7
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3412035
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to EXD3

  • exonuclease 3'-5' domain containing 3 (EXD3)
  • Exonuclease mut-7 (mut-7)
  • mut-7

Gene-IDs for different species

GENE IDSPECIES
54932 Homo sapiens
176347 Caenorhabditis elegans

Protein level used designations for EXD3

  • exonuclease 3'-5' domain-containing protein 3
  • probable exonuclease mut-7 homolog
Other products related to EXD3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com