FCN3 (Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen), FCN3)

Short Description: Ficolins are a group of proteins which consist of a collagen-like domain and a fibrinogen-like domain. In human serum, there are two types of ficolins, both of which have lectin activity. The protein encoded by this gene is a thermolabile beta-2-macroglycoprotein found in all human serum and is a member of the ficolin/opsonin p35 lectin family. The protein, which was initially identified based on its reactivity with sera from patients with systemic lupus erythematosus, has been shown to have a calcium-independent lectin activity. The protein can activate the complement pathway in association with MASPs and sMAP, thereby aiding in host defense through the activation of the lectin pathway. Alternative splicing occurs at this locus and two variants, each encoding a distinct isoform, have been identified. [provided by RefSeq, Jul 2008].
More information related to gene FCN3.
Products related to FCN3 Gene:
53 Products
Type
  • 50
  • 3
Species
  • 45
  • 4
  • 4
Application
  • 29
  • 15
  • 9
  • 7
  • 1
Fusion tag
  • 24
  • 8
  • 6
  • 4
  • 3
Vector Backbone
  • 4
  • 4
  • 3
  • 3
  • 3
Vector
  • 19
  • 15
  • 7
  • 4
  • 3
Insert
  • 20
  • 16
  • 7
  • 3
  • 2
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 24
  • 15
  • 10
  • 2
  • 1
Expression Type
  • 41
  • 21
  • 1
Selectable Marker
  • 16
  • 10
  • 1
Promoter
  • 17
  • 12
  • 8
  • 5
  • 4
Format
  • 22
  • 14
  • 9
  • 8

Type:
cDNA
Application:
Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
8547 (Human, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4035866
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
373682 (Xenopus laevis, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017832
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
373682 (Xenopus laevis, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017833
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
496672 (Xenopus tropicalis, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4059943
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
448367 (Xenopus tropicalis, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058861
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
Quantitative real-time PCR
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen)
Species:
Human
Synonyms:
FCNH, HAKA1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193197
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
8547 (Human, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4035867
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
373682 (Xenopus laevis, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017834
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
373682 (Xenopus laevis, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017835
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
496672 (Xenopus tropicalis, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4059944
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
448367 (Xenopus tropicalis, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058860
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
NCBI Accession:
NM_003665
Species:
Human
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3897450
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Species:
Human
Synonyms:
FCN3, Fcn3, fcn3-A
Insert length:
867 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4702376
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Species:
Human
Synonyms:
FCN3, Fcn3, fcn3-A
Insert length:
867 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4831506
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
8547 (Human, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3419866
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
Gene ID:
8547 (Human, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3423056
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
NCBI Accession:
NM_173452
Gene ID:
8547 (Human, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4939504
$309.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
NCBI Accession:
NM_003665
Gene ID:
8547 (Human, FCN3)
Synonyms:
FCN3, Fcn3, fcn3-A
Insert length:
900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4939505
$309.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
NCBI Accession:
NM_003665,NP_003656
Species:
Human
Synonyms:
FCN3, Fcn3, fcn3-A
Insert length:
900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5439839
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ficolin (Collagen/fibrinogen Domain Containing) 3 (Hakata Antigen) (FCN3)
NCBI Accession:
NM_173452,NP_775628
Species:
Human
Synonyms:
FCN3, Fcn3, fcn3-A
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5439838
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to FCN3

  • ficolin 3 (FCN3)
  • ficolin 3 (Fcn3)
  • ficolin-3 (fcn3-A)
  • FCNH
  • HAKA1

Gene-IDs for different species

GENE IDSPECIES
8547 Homo sapiens
100070924 Equus caballus
100736025 Cavia porcellus
100685339
107131870 Bos taurus
373682 Xenopus laevis

Protein level used designations for FCN3

  • H-ficolin
  • collagen/fibrinogen domain-containing lectin 3 p35
  • collagen/fibrinogen domain-containing protein 3
  • ficolin 3
  • ficolin-3
  • ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen)
  • LOW QUALITY PROTEIN: ficolin-3
Other products related to FCN3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com