GLRa2 (Glycine Receptor, alpha 2, GLRa2)

Short Description: The glycine receptor consists of two subunits, alpha and beta, and acts as a pentamer. The protein encoded by this gene is an alpha subunit and can bind strychnine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010].
More information related to gene GLRa2.
Products related to GLRa2 Gene:
131 Products
  • 124
  • 7
  • 75
  • 28
  • 28
  • 80
  • 27
  • 19
  • 16
  • 1
Fusion tag
  • 38
  • 25
  • 19
  • 11
  • 8
Vector Backbone
  • 12
  • 12
  • 10
  • 6
  • 6
  • 48
  • 46
  • 12
  • 9
  • 5
  • 54
  • 33
  • 21
  • 8
  • 6
  • 6
  • 1
Resistance Gene
  • 50
  • 38
  • 30
  • 6
  • 2
Expression Type
  • 107
  • 55
  • 11
Selectable Marker
  • 33
  • 26
  • 11
  • 1
  • 51
  • 31
  • 20
  • 13
  • 8
  • 67
  • 28
  • 27
  • 9

Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
GLRA2, Glra2, glra2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4211049
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Glycine Receptor, alpha 2 (GLRa2)
GLRA2, Glra2, glra2
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3560399
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Glycine Receptor, alpha 2
-20 °C
Catalog No. ABIN3192094
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Glycine Receptor, alpha 2 (GLRa2)
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5752457
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
GLRA2, Glra2, glra2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4211050
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5319609
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Glycine Receptor, alpha 2 (GLRa2)
NCBI Accession:
GLRA2, Glra2, glra2
Insert length:
3620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3384229
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Protein Expression
Glycine Receptor, alpha 2 (GLRa2)
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4437153
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Glycine Receptor, alpha 2 (GLRa2)
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4476058
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Glycine Receptor, alpha 2 (GLRa2)
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4703050
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Glycine Receptor, alpha 2 (GLRa2)
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4762433
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Glycine Receptor, alpha 2 (GLRa2)
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4767726
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Glycine Receptor, alpha 2 (GLRa2)
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4832180
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
GLRA2, Glra2, glra2
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3397043
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
GLRA2, Glra2, glra2
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3429382
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Glycine Receptor, alpha 2 (GLRa2)
NCBI Accession:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5440651
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Glycine Receptor, alpha 2 (GLRa2)
NCBI Accession:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5440652
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Glycine Receptor, alpha 2 (GLRa2)
NCBI Accession:
GLRA2, Glra2, glra2
Insert length:
1092 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5440654
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

RNA Interference
Glycine Receptor, alpha 2
Rat (Rattus)
HPLC purified
Available with shipment
  • Glra2 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3360025
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Glycine Receptor, alpha 2
HPLC purified
Available with shipment
  • GLRA2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3341612
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to GLRa2

  • glycine receptor alpha 2 (GLRA2)
  • glycine receptor, alpha 2 (Glra2)
  • glycine receptor, alpha 2 (glra2)
  • glycine receptor, alpha 2 subunit (Glra2)
  • GLR

Gene-IDs for different species

2742 Homo sapiens
24397 Rattus norvegicus
465502 Pan troglodytes
491746 Canis lupus familiaris
537660 Bos taurus
772019 Gallus gallus
793646 Danio rerio
100403670 Callithrix jacchus
100457201 Pongo abelii
100538616 Meleagris gallopavo
237213 Mus musculus

Protein level used designations for GLRa2

  • glycine receptor alpha 2 subunit
  • glycine receptor subunit alpha-2
  • glycine receptor, alpha-2 polypeptide
  • Glycine receptor alpha 2 subunit (glycine receptor, neonatal)
  • glycine receptor strychnine-binding subunit
  • glycine receptor, alpha 2 subunit
  • glycine receptor, alpha 2
  • glycin receptor,alpha 2
  • glycine receptor subunit alpha-2-like
Other products related to GLRa2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website