GLRa2 (Glycine Receptor, alpha 2, GLRa2)

Short Description: The glycine receptor consists of two subunits, alpha and beta, and acts as a pentamer. The protein encoded by this gene is an alpha subunit and can bind strychnine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010].
More information related to gene GLRa2.
Products related to GLRa2 Gene:
131 Products
Type
  • 124
  • 7
Species
  • 75
  • 28
  • 28
Application
  • 80
  • 27
  • 19
  • 16
  • 1
Fusion tag
  • 38
  • 25
  • 19
  • 11
  • 8
Vector Backbone
  • 12
  • 12
  • 10
  • 6
  • 6
Vector
  • 48
  • 46
  • 12
  • 9
  • 5
Insert
  • 54
  • 33
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 50
  • 38
  • 30
  • 6
  • 2
Expression Type
  • 107
  • 55
  • 11
Selectable Marker
  • 33
  • 26
  • 11
  • 1
Promoter
  • 51
  • 31
  • 20
  • 13
  • 8
Format
  • 67
  • 28
  • 27
  • 9
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5752457
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
Synonyms:
GLRA2, Glra2, glra2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211049
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3560399
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Glycine Receptor, alpha 2
Species:
Human
Synonyms:
GLR, RNNEOGLY
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192094
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
Synonyms:
GLRA2, Glra2, glra2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211050
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5319609
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4437153
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4476058
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4832180
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4762433
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4767726
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4703050
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Glycine Receptor, alpha 2 (GLRa2)
NCBI Accession:
NM_002063,NP_002054
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
3620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3384229
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
Synonyms:
GLRA2, Glra2, glra2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3397043
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Glycine Receptor, alpha 2 (GLRa2)
Gene ID:
2742 (Human, GLRa2)
Synonyms:
GLRA2, Glra2, glra2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3429382
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Glycine Receptor, alpha 2 (GLRa2)
NCBI Accession:
NM_001171942,NP_001165413
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1092 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440654
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Glycine Receptor, alpha 2 (GLRa2)
NCBI Accession:
NM_002063,NP_002054
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440651
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Glycine Receptor, alpha 2 (GLRa2)
NCBI Accession:
NM_001118885,NP_001112357
Species:
Human
Synonyms:
GLRA2, Glra2, glra2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440652
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Glycine Receptor, alpha 2
Species:
Mouse (Murine)
Synonyms:
GLR, RNNEOGLY
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Glra2 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3270808
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Glycine Receptor, alpha 2
Species:
Human
Synonyms:
GLR, RNNEOGLY
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • GLRA2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3341612
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to GLRa2

  • glycine receptor alpha 2 (GLRA2)
  • glycine receptor, alpha 2 (Glra2)
  • glycine receptor, alpha 2 (glra2)
  • glycine receptor, alpha 2 subunit (Glra2)
  • GLR
  • RNNEOGLY

Gene-IDs for different species

GENE IDSPECIES
2742 Homo sapiens
24397 Rattus norvegicus
465502 Pan troglodytes
491746 Canis lupus familiaris
537660 Bos taurus
772019 Gallus gallus
793646 Danio rerio
100403670 Callithrix jacchus
100457201 Pongo abelii
100538616 Meleagris gallopavo
237213 Mus musculus

Protein level used designations for GLRa2

  • glycine receptor alpha 2 subunit
  • glycine receptor subunit alpha-2
  • glycine receptor, alpha-2 polypeptide
  • Glycine receptor alpha 2 subunit (glycine receptor, neonatal)
  • glycine receptor strychnine-binding subunit
  • glycine receptor, alpha 2 subunit
  • glycine receptor, alpha 2
  • glycin receptor,alpha 2
  • glycine receptor subunit alpha-2-like
Other products related to GLRa2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com