IL11RA (Interleukin 11 Receptor, alpha, IL11RA)

Short Description: Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the gp130 transducing subunit in their high affinity receptors. This gene encodes the IL-11 receptor, which is a member of the hematopoietic cytokine receptor family. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012].
More information related to gene IL11RA.
Products related to IL11RA Gene:
117 Products
Type
  • 112
  • 5
Species
  • 63
  • 13
  • 13
  • 12
  • 12
Application
  • 89
  • 17
  • 9
  • 7
  • 3
Fusion tag
  • 33
  • 13
  • 11
  • 11
  • 11
Vector Backbone
  • 5
  • 5
  • 5
  • 5
  • 5
Vector
  • 75
  • 19
  • 5
  • 4
  • 3
Insert
  • 76
  • 22
  • 7
  • 3
  • 2
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 67
  • 29
  • 14
  • 2
  • 2
Expression Type
  • 55
  • 47
  • 22
  • 2
Selectable Marker
  • 55
  • 14
  • 10
Promoter
  • 63
  • 22
  • 12
  • 4
  • 4
Format
  • 88
  • 10
  • 10
  • 9

Type:
ORF
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Species:
Human
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Insert length:
1269 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5731833
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
NCBI Accession:
NM_004512,NP_004503
Species:
Human
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Insert length:
1269 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5373256
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Gene ID:
508932 (Cow (Bovine), IL11RA)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856157
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Gene ID:
100101801 (Xenopus tropicalis, IL11RA)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031583
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Gene ID:
3590 (Human, IL11RA)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084977
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
NCBI Accession:
NM_139116
Species:
Rat (Rattus)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888334
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
NCBI Accession:
NM_004512
Species:
Human
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887121
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
NCBI Accession:
NM_010549
Species:
Mouse (Murine)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103880
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
NCBI Accession:
XM_001093448
Species:
Rhesus Monkey
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104144
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
NCBI Accession:
XM_005626742
Species:
Dog (Canine)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104145
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Interleukin 11 Receptor, alpha
Species:
Mouse (Murine)
Synonyms:
CRSDA, fi26e06, il-11ra, wu:fi26e06, AI314697, GP130, Il-11ra, Il11ra, Il11ra2, NR1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193662
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Interleukin 11 Receptor, alpha
Species:
Rat (Rattus)
Synonyms:
CRSDA, fi26e06, il-11ra, wu:fi26e06, AI314697, GP130, Il-11ra, Il11ra, Il11ra2, NR1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196337
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Interleukin 11 Receptor, alpha
Species:
Human
Synonyms:
CRSDA, fi26e06, il-11ra, wu:fi26e06, AI314697, GP130, Il-11ra, Il11ra, Il11ra2, NR1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188637
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Gene ID:
508932 (Cow (Bovine), IL11RA)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856159
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Gene ID:
100101801 (Xenopus tropicalis, IL11RA)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031582
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Gene ID:
3590 (Human, IL11RA)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084978
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Gene ID:
3590 (Human, IL11RA)
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Insert length:
1269 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312414
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Species:
Human
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Insert length:
1269 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4438001
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Species:
Human
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Insert length:
1269 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4476906
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Interleukin 11 Receptor, alpha (IL11RA)
Species:
Human
Synonyms:
IL11RA, il11ra, Il11ra1, Il11ra
Insert length:
1269 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4768574
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to IL11RA

  • interleukin 11 receptor subunit alpha (IL11RA)
  • interleukin 11 receptor, alpha (il11ra)
  • interleukin 11 receptor subunit alpha (il11ra)
  • interleukin 11 receptor subunit alpha 1 (Il11ra1)
  • interleukin 11 receptor, alpha chain 1 (Il11ra1)
  • interleukin 11 receptor subunit alpha (Il11ra)
  • AI314697
  • CRSDA
  • fi26e06
  • GP130
  • il-11ra
  • Il-11ra
  • Il11ra
  • Il11ra2
  • NR1
  • wu:fi26e06

Gene-IDs for different species

GENE IDSPECIES
3590 Homo sapiens
334010 Danio rerio
481588 Canis lupus familiaris
508932 Bos taurus
693251 Gallus gallus
100101801 Xenopus (Silurana) tropicalis
100190822 Pongo abelii
245983 Rattus norvegicus
16157 Mus musculus
100723182 Cavia porcellus
700201 Macaca mulatta

Protein level used designations for IL11RA

  • IL-11 receptor subunit alpha
  • IL-11R subunit alpha
  • interleukin-11 receptor alpha chain
  • interleukin-11 receptor subunit alpha
  • interleukin 11 receptor alpha chain
  • interleukin 11 receptor, alpha
  • IL-11R-alpha
  • IL-11RA
  • Interleukin-11 receptor alpha chain
  • IL-11 receptor subunit alpha-1
  • IL-11R subunit alpha-1
  • IL-11R-alpha-1
  • IL-11RA1
  • Il-11ra-alpha
  • NR-1
  • enhancer trap locus homolog 2
  • etl-2
  • interleukin 11 receptor, alpha chain 2
  • interleukin-11 receptor subunit alpha-1
  • locus 2
  • novel cytokine receptor 1
Other products related to IL11RA such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com