Insulin (Insulin, INS)

Short Description: After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010].
More information related to gene Insulin.
Products related to Insulin Gene:
79 Products
Data Quality
  • 1
Type
  • 75
  • 4
Species
  • 71
  • 4
  • 2
  • 2
Application
  • 48
  • 17
  • 14
  • 11
  • 1
Fusion tag
  • 34
  • 11
  • 8
  • 5
  • 4
Vector Backbone
  • 5
  • 4
  • 4
  • 4
  • 3
Vector
  • 32
  • 21
  • 7
  • 6
  • 4
Insert
  • 31
  • 22
  • 11
  • 5
  • 4
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 32
  • 28
  • 12
  • 3
  • 2
Expression Type
  • 53
  • 30
  • 11
  • 2
Selectable Marker
  • 18
  • 16
  • 11
  • 1
Promoter
  • 20
  • 20
  • 19
  • 6
  • 6
Format
  • 40
  • 16
  • 14
  • 9

Type:
ORF
Application:
Cloning
Gene:
Insulin (INS)
Species:
Human
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Insert length:
333 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5721515
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Insulin (INS)
NCBI Accession:
NM_000207,NP_000198
Species:
Human
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Insert length:
333 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5340243
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Insulin (INS)
NCBI Accession:
NM_001185097
Gene ID:
3630 (Human, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Insert length:
333 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4919326
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin (INS)
Gene ID:
378695 (Xenopus laevis, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484199
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin (INS)
Gene ID:
378695 (Xenopus laevis, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484200
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Insulin (INS)
Gene ID:
280829 (Cow (Bovine), INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838417
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Insulin (INS)
Gene ID:
100101718 (Xenopus tropicalis, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031526
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin (INS)
Gene ID:
3630 (Human, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034929
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin (INS)
NCBI Accession:
NM_000207
Species:
Human
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561281
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Insulin
Species:
Human
Synonyms:
ins1, xins, ins1-a, Insulin, IDDM2, ILPR, IRDN, MODY10, AA986540, Ins-2, InsII, Mody, Mody4, proinsulin, zgc:109842
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189330
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Insulin (INS)
Gene ID:
280829 (Cow (Bovine), INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838415
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin (INS)
Gene ID:
378695 (Xenopus laevis, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018162
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin (INS)
Gene ID:
378695 (Xenopus laevis, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018163
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Insulin (INS)
Gene ID:
100101718 (Xenopus tropicalis, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031527
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin (INS)
Gene ID:
3630 (Human, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034930
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Insulin (INS)
Gene ID:
3630 (Human, INS)
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Insert length:
333 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312937
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Insulin (INS)
NCBI Accession:
NM_000207
Species:
Human
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912104
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Insulin (INS)
NCBI Accession:
NM_000207
Species:
Human
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912106
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Insulin (INS)
NCBI Accession:
NM_000207
Species:
Human
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912107
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Insulin (INS)
NCBI Accession:
NM_000207
Species:
Human
Synonyms:
ins, PIN, INS, Ins, INS-IGF2, Ins2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3912108
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Insulin

  • insulin (ins)
  • insulin precursor (PIN)
  • insulin (INS)
  • insulin (Ins)
  • insulin (INS-IGF2)
  • insulin II (Ins2)
  • preproinsulin (ins)
  • AA986540
  • IDDM2
  • ILPR
  • Ins-2
  • ins1
  • ins1-a
  • InsII
  • Insulin
  • IRDN
  • Mody
  • Mody4
  • MODY10
  • proinsulin
  • xins
  • zgc:109842

Gene-IDs for different species

GENE IDSPECIES
100101718 Xenopus (Silurana) tropicalis
100533403 Aplysia californica
3630 Homo sapiens
397415 Sus scrofa
280829 Bos taurus
100009181 Oryctolagus cuniculus
101684928 Mustela putorius furo
483665 Canis lupus familiaris
493804 Felis catus
100379579 Cavia porcellus
396145 Gallus gallus
101794427 Anas platyrhynchos
449570 Pan troglodytes
16334 Mus musculus
100060077 Equus caballus
30262 Danio rerio

Protein level used designations for Insulin

  • insulin I
  • insulin
  • preproinsulin
  • proinsulin
  • insulin-2
  • insa
Other products related to Insulin such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com