MUC17 (Mucin 17, Cell Surface Associated, MUC17)

Short Description: Membrane mucins, such as MUC17, function in epithelial cells to provide cytoprotection, maintain luminal structure, provide signal transduction, and confer antiadhesive properties upon cancer cells that lose their apical/basal polarization.
More information related to gene MUC17.
Products related to MUC17 Gene:
26 Products
Type
  • 25
  • 1
Species
  • 26
Application
  • 10
  • 8
  • 7
  • 5
Fusion tag
  • 7
  • 4
  • 4
  • 3
  • 2
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 1
Vector
  • 9
  • 8
  • 4
  • 3
  • 1
Insert
  • 8
  • 7
  • 3
  • 3
  • 2
Oligo-Type
  • 1
Resistance Gene
  • 11
  • 11
  • 2
  • 2
  • 1
Expression Type
  • 25
  • 18
Selectable Marker
  • 10
  • 8
Promoter
  • 12
  • 7
  • 4
  • 4
  • 2
Format
  • 9
  • 9
  • 6
  • 2

Application:
RNA Interference
Gene:
Mucin 17, Cell Surface Associated
Species:
Human
Synonyms:
MUC3
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • MUC17 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3312346
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mucin 17, Cell Surface Associated (MUC17)
NCBI Accession:
NM_001040105
Species:
Human
Synonyms:
MUC17
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MUC17
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5140026
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Gene ID:
140453 (Human, MUC17)
Synonyms:
MUC17
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5049507

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5030562
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mucin 17, Cell Surface Associated (MUC17)
NCBI Accession:
NM_001040105
Species:
Human
Synonyms:
MUC17
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MUC17
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5255519
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
shRNA
Application:
RNA Interference
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Gene ID:
140453 (Human, MUC17)
Synonyms:
MUC17
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN4152716

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN4152715
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Species:
Human
Synonyms:
MUC17
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948188

Components:
  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3715856
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Species:
Human
Synonyms:
MUC17
Vector type:
Retroviral Vector
Vector backbone:
pGFP-V-RS
Resistance Gene:
Kanamycin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948187

Components:
  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3736195
$715.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Species:
Human
Synonyms:
MUC17
Vector type:
Retroviral Vector
Vector backbone:
pRS
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948189

Components:
  • Gene-specific shRNA expression pRS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3653292
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Gene ID:
140453 (Human, MUC17)
Synonyms:
MUC17
Vector type:
Mammalian Expression Vector
Vector backbone:
pU6-GFP-Neo
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter, U6 Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
This product contains 3 separate slightly different shRNA sequences which knock down human MUC17 gene specifically. Each vial contains 50 μg of lyophilized shRNA.
Format:
Lyophilized
Storage:
4 °C,-20 °C,-80 °C
Catalog No. ABIN5830037
$749.44
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mucin 17, Cell Surface Associated (MUC17)
NCBI Accession:
NM_001040105
Species:
Human
Synonyms:
MUC17
Insert length:
3678 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4489111
$775.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mucin 17, Cell Surface Associated (MUC17)
NCBI Accession:
NM_001040105
Species:
Human
Synonyms:
MUC17
Insert length:
3678 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4632580
$775.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mucin 17, Cell Surface Associated (MUC17)
NCBI Accession:
NM_001040105
Species:
Human
Synonyms:
MUC17
Insert length:
3678 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4780801
$775.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mucin 17, Cell Surface Associated (MUC17)
NCBI Accession:
NM_001040105
Species:
Human
Synonyms:
MUC17
Insert length:
3678 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4424023
$775.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mucin 17, Cell Surface Associated (MUC17)
NCBI Accession:
NM_001040105
Species:
Human
Synonyms:
MUC17
Insert length:
3678 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4706578
$775.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Mucin 17, Cell Surface Associated (MUC17)
NCBI Accession:
NM_001040105
Species:
Human
Synonyms:
MUC17
Insert length:
3678 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4835708
$775.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Species:
Human
Synonyms:
MUC17
Vector type:
Lentiviral Vector
Vector backbone:
pGFP-C-shLenti
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948186

Components:
  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3756533
$815.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mucin 17, Cell Surface Associated (MUC17)
NCBI Accession:
NM_001040105
Species:
Human
Synonyms:
MUC17
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with a set of 3 gRNAs (3 x 300 μL) covering different sequences of MUC17
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5140025
$920.00
3 x 300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Species:
Human
Synonyms:
MUC17
Insert length:
3678 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4507817
$975.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Species:
Human
Synonyms:
MUC17
Insert length:
3678 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4569026
$975.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Mucin 17, Cell Surface Associated (MUC17)
Species:
Human
Synonyms:
MUC17
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • MUC17 gRNA vector 1 in pCAS-Guide vector.
  • MUC17 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3243742
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to MUC17

  • mucin 17, cell surface associated (MUC17)
  • MUC3

Gene-IDs for different species

GENE IDSPECIES
140453 Homo sapiens

Protein level used designations for MUC17

  • MUC-17
  • MUC-3
  • membrane mucin MUC17
  • mucin-17
  • secreted mucin MUC17
  • small intestinal mucin MUC3
  • small intestinal mucin-3
Other products related to MUC17 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com