NCS1 (Neuronal Calcium Sensor 1, NCS1)

Short Description: This gene is a member of the neuronal calcium sensor gene family, which encode calcium-binding proteins expressed predominantly in neurons. The protein encoded by this gene regulates G protein-coupled receptor phosphorylation in a calcium-dependent manner and can substitute for calmodulin. The protein is associated with secretory granules and modulates synaptic transmission and synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene NCS1.
Products related to NCS1 Gene:
119 Products
Type
  • 114
  • 5
Species
  • 59
  • 28
  • 24
  • 4
  • 2
Application
  • 70
  • 27
  • 25
  • 20
  • 1
Fusion tag
  • 46
  • 18
  • 11
  • 11
  • 8
Vector Backbone
  • 8
  • 8
  • 7
  • 7
  • 6
Vector
  • 43
  • 42
  • 10
  • 9
  • 7
Insert
  • 37
  • 36
  • 21
  • 10
  • 8
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 47
  • 40
  • 22
  • 5
  • 2
Expression Type
  • 96
  • 55
  • 11
Selectable Marker
  • 28
  • 28
  • 11
  • 1
Promoter
  • 35
  • 33
  • 21
  • 10
  • 10
Format
  • 50
  • 28
  • 23
  • 18
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5741248
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Neuronal Calcium Sensor 1 (NCS1)
NCBI Accession:
NM_014286,NP_055101
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Insert length:
573 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5404195
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Gene ID:
394570 (Xenopus tropicalis, NCS1)
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881467
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Gene ID:
399297 (Xenopus laevis, NCS1)
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846721
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Gene ID:
23413 (Human, NCS1)
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4089810
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562727
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Neuronal Calcium Sensor 1
Species:
Human
Synonyms:
FREQ, NCS-1, LOC100189965, FLUP, freq, freqa, zgc:63620, 9430075O15Rik, A730032G13Rik, AI836659, Freq, Mfreq, flup, xfreq, MGC75953, freqb, wu:fa55b03
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192613
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Gene ID:
394570 (Xenopus tropicalis, NCS1)
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881468
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Gene ID:
399297 (Xenopus laevis, NCS1)
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846720
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Gene ID:
23413 (Human, NCS1)
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4089809
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Gene ID:
23413 (Human, NCS1)
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Insert length:
573 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318334
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Neuronal Calcium Sensor 1 (NCS1)
NCBI Accession:
NM_014286,NP_055101
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3317921
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Insert length:
573 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4767449
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Insert length:
573 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4762156
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Insert length:
573 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4436876
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Insert length:
573 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475781
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Neuronal Calcium Sensor 1 (NCS1)
Gene ID:
23413 (Human, NCS1)
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3409201
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Neuronal Calcium Sensor 1 (NCS1)
NCBI Accession:
NM_001128826,NP_001122298
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3302909
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Neuronal Calcium Sensor 1 (NCS1)
NCBI Accession:
NM_024366,NP_077342
Species:
Rat (Rattus)
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Insert length:
573 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331930
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Neuronal Calcium Sensor 1 (NCS1)
NCBI Accession:
NM_001128826,NP_001122298
Species:
Human
Synonyms:
NCS1, ncs1a, freq, Ncs1, ncs1, ncs1.L, cse-1, MGYG_03475, PGTG_09250, Tsp_06748, ncs-1, ncs1b
Insert length:
519 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5404196
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to NCS1

  • neuronal calcium sensor 1 (NCS1)
  • neuronal calcium sensor 1a (ncs1a)
  • frequenin homolog (freq)
  • neuronal calcium sensor 1 (Ncs1)
  • neuronal calcium sensor 1 (ncs1)
  • neuronal calcium sensor 1 L homeolog (ncs1.L)
  • calcium sensor-1 (cse-1)
  • neuronal calcium sensor 1 (MGYG_03475)
  • calcium-binding protein NCS-1 (PGTG_09250)
  • neuronal calcium sensor 1 (Tsp_06748)
  • Neuronal calcium sensor 1 (ncs1)
  • Neuronal calcium sensor 1 (ncs-1)
  • neuronal calcium sensor 1b (ncs1b)
  • 9430075O15Rik
  • A730032G13Rik
  • AI836659
  • flup
  • FLUP
  • Freq
  • FREQ
  • freq
  • freqa
  • freqb
  • LOC100189965
  • Mfreq
  • MGC75953
  • NCS-1
  • wu:fa55b03
  • xfreq
  • zgc:63620

Gene-IDs for different species

GENE IDSPECIES
526544 Bos taurus
100189965 Taeniopygia guttata
23413 Homo sapiens
393437 Danio rerio
100303592 Saccoglossus kowalevskii
100340886 Oryctolagus cuniculus
14299 Mus musculus
65153 Rattus norvegicus
394570 Xenopus (Silurana) tropicalis
399297 Xenopus laevis
3873635 Neurospora crassa OR74A
10028582 Arthroderma gypseum CBS 118893
10545012 Puccinia graminis f. sp. tritici CRL 75-36-700-3
10911856 Trichinella spiralis
100172236 Pongo abelii
100380555 Salmo salar
396336 Gallus gallus
180448 Caenorhabditis elegans
553174 Danio rerio
491294 Canis lupus familiaris
100732388 Cavia porcellus

Protein level used designations for NCS1

  • frequenin homolog
  • frequenin-like protein
  • neuronal calcium sensor-1
  • putative frequenin
  • frequenin-like ubiquitous protein
  • frequenin homolog a
  • ncs-1a
  • neuronal calcium sensor-1a
  • NCS-1
  • neuronal calcium sensor 1
  • frequenin
  • Neuronal calcium sensor 1
  • neuronal calcium sensor homologue
  • fa55b03
  • frequenin homolog b
  • ncs-1b
  • neuronal calcium sensor-1b
Other products related to NCS1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com