OR52B2 (Olfactory Receptor, Family 52, Subfamily B, Member 2, OR52B2)

Short Description: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008].
More information related to gene OR52B2.
Products related to OR52B2 Gene:
37 Products
  • 36
  • 1
  • 37
  • 17
  • 9
  • 8
  • 7
Fusion tag
  • 13
  • 6
  • 4
  • 4
  • 3
Vector Backbone
  • 4
  • 2
  • 2
  • 2
  • 2
  • 13
  • 10
  • 5
  • 4
  • 3
  • 13
  • 9
  • 7
  • 3
  • 2
  • 1
Resistance Gene
  • 16
  • 12
  • 6
  • 2
  • 2
Expression Type
  • 31
  • 19
Selectable Marker
  • 14
  • 10
  • 12
  • 12
  • 4
  • 4
  • 2
  • 13
  • 9
  • 8
  • 7

Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
Gene ID:
255725 (Human, OR52B2)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4014630
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
Gene ID:
255725 (Human, OR52B2)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4014629
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
Gene ID:
255725 (Human, OR52B2)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4014628
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
Gene ID:
255725 (Human, OR52B2)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4014627
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
Gene ID:
255725 (Human, OR52B2)
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3415483
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Insert length:
972 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5443482
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of OR52B2
Viral Particles
-80 °C
Catalog No. ABIN5143668
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

RNA Interference
Olfactory Receptor, Family 52, Subfamily B, Member 2
HPLC purified
Available with shipment
  • OR52B2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3313832
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
GFP tag
Stable, Transient

The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5443481
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Genome Editing with Engineered Nucleases
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
Gene ID:
255725 (Human, OR52B2)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5033513
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Insert length:
972 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5753349
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Insert length:
972 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4424387
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
Insert length:
972 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4570094
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
Insert length:
972 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4508885
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Insert length:
972 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4489477
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Insert length:
972 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4707647
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Insert length:
972 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4836777
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Insert length:
972 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4632946
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Insert length:
972 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4781167
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Olfactory Receptor, Family 52, Subfamily B, Member 2 (OR52B2)
NCBI Accession:
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of OR52B2
Viral Particles
-80 °C
Catalog No. ABIN5259175
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
  • <
  • 1

Synonyms and alternative names related to OR52B2

  • olfactory receptor family 52 subfamily B member 2 (OR52B2)
  • OR11-70

Gene-IDs for different species

255725 Homo sapiens

Protein level used designations for OR52B2

  • olfactory receptor 52B2
  • olfactory receptor OR11-70
Other products related to OR52B2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com