OR52D1 (Olfactory Receptor, Family 52, Subfamily D, Member 1, OR52D1)

Short Description: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008].
More information related to gene OR52D1.
Products related to OR52D1 Gene:
32 Products
Type
  • 31
  • 1
Species
  • 32
Application
  • 16
  • 8
  • 7
  • 5
Fusion tag
  • 8
  • 6
  • 4
  • 4
  • 3
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 2
Vector
  • 13
  • 10
  • 4
  • 3
  • 1
Insert
  • 9
  • 8
  • 7
  • 3
  • 2
Oligo-Type
  • 1
Resistance Gene
  • 12
  • 12
  • 6
  • 2
  • 1
Expression Type
  • 31
  • 19
Selectable Marker
  • 10
  • 10
Promoter
  • 12
  • 12
  • 4
  • 4
  • 2
Format
  • 13
  • 9
  • 8
  • 2

Type:
ORF
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163,NP_001005163
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5443486
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1
Species:
Human
Synonyms:
OR11-43
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • OR52D1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3315120
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163
Species:
Human
Synonyms:
OR52D1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of OR52D1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5143670
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
Gene ID:
390066 (Human, OR52D1)
Synonyms:
OR52D1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5055585

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5036640
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4489479
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4508887
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4632948
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4707649
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4781169
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4424389
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4570096
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4836779
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163
Species:
Human
Synonyms:
OR52D1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of OR52D1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5259177
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
Species:
Human
Synonyms:
OR52D1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5443485
$560.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163,NP_001005163
Species:
Human
Synonyms:
OR52D1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3303436
$640.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
NCBI Accession:
NM_001005163,NP_001005163
Species:
Human
Synonyms:
OR52D1
Insert length:
957 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5443488
$700.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
Gene ID:
390066 (Human, OR52D1)
Synonyms:
OR52D1
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN4197683

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN4197682
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
Species:
Human
Synonyms:
OR52D1
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948188

Components:
  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3715328
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
Species:
Human
Synonyms:
OR52D1
Vector type:
Retroviral Vector
Vector backbone:
pGFP-V-RS
Resistance Gene:
Kanamycin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948187

Components:
  • Gene-specific shRNA in pGFPC-shLenti vector, 4 unique constructs per gene, 5 ug per vial.
  • HuSH 29-mer Scrambled in pGFP-C-shLenti 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3735667
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Olfactory Receptor, Family 52, Subfamily D, Member 1 (OR52D1)
Species:
Human
Synonyms:
OR52D1
Vector type:
Retroviral Vector
Vector backbone:
pRS
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948189

Components:
  • Gene-specific shRNA expression pRS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3652764
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to OR52D1

  • olfactory receptor family 52 subfamily D member 1 (OR52D1)
  • OR11-43

Gene-IDs for different species

GENE IDSPECIES
390066 Homo sapiens

Protein level used designations for OR52D1

  • HOR 5'Beta14
  • odorant receptor HOR5'beta14
  • olfactory receptor 52D1
  • olfactory receptor OR11-43
Other products related to OR52D1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com