SOX1 (SRY (Sex Determining Region Y)-Box 1, SOX1)

Short Description: This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. In mice, a similar protein regulates the gamma-crystallin genes and is essential for lens development. [provided by RefSeq, Jul 2008].
More information related to gene SOX1.
Products related to SOX1 Gene:
68 Products
Type
  • 66
  • 2
Species
  • 32
  • 27
  • 5
  • 2
  • 2
Application
  • 38
  • 17
  • 16
  • 12
Fusion tag
  • 27
  • 10
  • 6
  • 6
  • 6
Vector Backbone
  • 4
  • 4
  • 4
  • 3
  • 3
Vector
  • 24
  • 22
  • 8
  • 6
  • 4
Insert
  • 27
  • 14
  • 13
  • 6
  • 4
Oligo-Type
  • 2
Resistance Gene
  • 30
  • 22
  • 10
  • 4
  • 2
Expression Type
  • 62
  • 34
Selectable Marker
  • 19
  • 18
Promoter
  • 22
  • 19
  • 9
  • 8
  • 6
Format
  • 23
  • 18
  • 14
  • 13

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
Gene ID:
562710 (Zebrafish (Danio rerio), SOX1)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066091
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
Gene ID:
779569 (Xenopus tropicalis, SOX1)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3869704
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
Gene ID:
734174 (Xenopus laevis, SOX1)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024834
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
Gene ID:
562710 (Zebrafish (Danio rerio), SOX1)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066092
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
NCBI Accession:
NM_005986
Species:
Human
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Insert length:
1176 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5757912
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
Gene ID:
779569 (Xenopus tropicalis, SOX1)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3869703
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
Gene ID:
734174 (Xenopus laevis, SOX1)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024833
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
Gene ID:
20664 (Mouse (Murine), SOX1)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3407022
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
Gene ID:
20664 (Mouse (Murine), SOX1)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3407052
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
NCBI Accession:
NM_005986,NP_005977
Species:
Human
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Insert length:
1176 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5458385
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
SRY (Sex Determining Region Y)-Box 1
Species:
Human
Synonyms:
BB176347, Sox-1, XlSox1, xSox1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • SOX1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3344299
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
SRY (Sex Determining Region Y)-Box 1
Species:
Mouse (Murine)
Synonyms:
BB176347, Sox-1, XlSox1, xSox1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Sox1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3269204
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
NCBI Accession:
NM_009233
Species:
Mouse (Murine)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Sox1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5152543
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
NCBI Accession:
NM_005986
Species:
Human
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SOX1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5152541
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
Gene ID:
6656 (Human, SOX1)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5061208

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5042263
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
NCBI Accession:
NM_009233,NP_033259
Species:
Mouse (Murine)
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Insert length:
1176 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3371636
$520.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
NCBI Accession:
NM_005986
Species:
Human
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Insert length:
1251 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4512826
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
NCBI Accession:
NM_005986
Species:
Human
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Insert length:
1251 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4574032
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
NCBI Accession:
NM_005986
Species:
Human
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Insert length:
1251 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4711584
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SRY (Sex Determining Region Y)-Box 1 (SOX1)
NCBI Accession:
NM_005986
Species:
Human
Synonyms:
SOX1, Sox1, sox1.S, sox1b
Insert length:
1251 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4840715
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to SOX1

  • SRY-box 1 (SOX1)
  • SRY (sex determining region Y)-box 1 (Sox1)
  • SRY-box 1 S homeolog (sox1.S)
  • SRY (sex determining region Y)-box 1b (sox1b)
  • SRY box 1 (Sox1)
  • SRY-box 1 (Sox1)
  • BB176347
  • Sox-1
  • XlSox1
  • xSox1

Gene-IDs for different species

GENE IDSPECIES
6656 Homo sapiens
100349813 Oryctolagus cuniculus
20664 Mus musculus
734174 Xenopus laevis
374240 Gallus gallus
607464 Canis lupus familiaris
618135 Bos taurus
562710 Danio rerio
100912302 Rattus norvegicus
101787499 Cavia porcellus
100615508 Pan troglodytes
110255866 Sus scrofa
100448714 Pongo abelii

Protein level used designations for SOX1

  • SRY-related HMG-box gene 1
  • transcription factor SOX-1
  • SRY (sex determining region Y)-box 3
  • SRY-box containing protein
  • sex determining region Y-box 1
  • transcription factor Sox-1
  • transcription factor Sox-1b
  • transcription factor sox1b
  • SRY (sex determining region Y)-box 1
  • transcription factor SOX-1-like
Other products related to SOX1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com