ULBP2 (UL16 Binding Protein 2, ULBP2)

Short Description: Ligand for the NKG2D receptor, together with at least ULBP1 and ULBP3. ULBPs activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. Binding of ULBPs ligands to NKG2D induces calcium mobilization and activation of the JAK2, STAT5, ERK and PI3K kinase/Akt signal transduction pathway. In CMV infected cells, interacts with soluble CMV glycoprotein UL16. The interaction with UL16 blocked the interaction with the NKG2D receptor, providing a mechanism by which CMV infected cells might escape the immune system. UL16 also causes ULBP2 to be retained in the ER and cis- Golgi apparatus so that it does not reach the cell surface.
More information related to gene ULBP2.
Products related to ULBP2 Gene:
48 Products
Type
  • 46
  • 2
Species
  • 48
Application
  • 29
  • 9
  • 8
  • 7
  • 1
Fusion tag
  • 14
  • 6
  • 5
  • 4
  • 4
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 2
Vector
  • 23
  • 13
  • 4
  • 3
  • 1
Insert
  • 20
  • 12
  • 7
  • 3
  • 2
Oligo-Type
  • 1
  • 1
Resistance Gene
  • 21
  • 17
  • 6
  • 2
  • 2
Expression Type
  • 33
  • 19
  • 11
Selectable Marker
  • 11
  • 10
  • 9
Promoter
  • 15
  • 12
  • 12
  • 5
  • 4
Format
  • 27
  • 9
  • 8
  • 4

Type:
ORF
Application:
Cloning
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5760500
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UL16 Binding Protein 2 (ULBP2)
NCBI Accession:
NM_025217,NP_079493
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5466198
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UL16 Binding Protein 2 (ULBP2)
Gene ID:
80328 (Human, ULBP2)
Synonyms:
ULBP2, LOC100355436
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879505
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3570723
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
UL16 Binding Protein 2
Species:
Human
Synonyms:
N2DL2, RAET1H
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190136
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UL16 Binding Protein 2 (ULBP2)
Gene ID:
80328 (Human, ULBP2)
Synonyms:
ULBP2, LOC100355436
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879506
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
UL16 Binding Protein 2 (ULBP2)
Gene ID:
80328 (Human, ULBP2)
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5311917
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4417810
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4626367
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4482896
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4774588
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4713734
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4842865
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
UL16 Binding Protein 2 (ULBP2)
NCBI Accession:
NM_025217,NP_079493
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
1368 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3392975
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
UL16 Binding Protein 2 (ULBP2)
NCBI Accession:
NM_025217
Species:
Human
Synonyms:
ULBP2, LOC100355436
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ULBP2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5157415
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
UL16 Binding Protein 2
Species:
Human
Synonyms:
N2DL2, RAET1H
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ULBP2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3288931
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5466197
$460.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
UL16 Binding Protein 2 (ULBP2)
Gene ID:
80328 (Human, ULBP2)
Synonyms:
ULBP2, LOC100355436
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5062888

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5043943
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4514983
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
UL16 Binding Protein 2 (ULBP2)
Species:
Human
Synonyms:
ULBP2, LOC100355436
Insert length:
741 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4576193
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ULBP2

  • UL16 binding protein 2 (ULBP2)
  • NKG2D ligand 2-like (LOC100355436)
  • N2DL2
  • RAET1H

Gene-IDs for different species

GENE IDSPECIES
80328 Homo sapiens
100355436 Oryctolagus cuniculus

Protein level used designations for ULBP2

  • ALCAN-alpha
  • N2DL-2
  • NKG2D ligand 2
  • NKG2DL2
  • UL16-binding protein 2
  • retinoic acid early transcript 1 H
  • retinoic acid early transcript 1H
Other products related to ULBP2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com